write a short note on genetic diversity and proper use of resource​ ?

Answers

Answer 1

Explanation:

Genetic diversity is the total number of genetic characteristics in the genetic makeup of a species, it ranges widely from the number of species to differences within species and can be attributed to the span of survival for a species. ... Genetic diversity serves as a way for populations to adapt to changing environments.

The need to increase efficiency and productivity while preserving natural resources, especially water and soil, is great. ... Advertisement. In light of these realities, growers are under pressure to produce more, pollute less, fulfill consumer preferences, and make a living.


Related Questions

How do glands of the endocrine system help your body maintain homeostasis?

Answers

The glands of the endocrine system secrete hormones into the bloodstream to maintain homeostasis and regulate metabolism. The hypothalamus and the pituitary gland are the command and control centers, directing hormones to other glands and throughout the body.

Angelica is a girl with blond hair and blue eyes. She is very popular in school but
gets into trouble for her attitude and inappropriate language. Many people blame
her inappropriate language on her "genetics" from her parents. Label all of
Angelica's traits as inherited or acquired. Are people right or wrong for blaming her
language on "genetics" or inherited traits? Explain.

Answers

Answer:

Yes they are wrong

Explanation:

I've met many people who are the sweetest things but their parents are a different story it all depends on who you are around and what you take in from other.

How has the world population changed in the last 200 years?

Answers

The world population has greatly increased in the last 200 years. Hope this helps :-)
the world population has increased and more humans are being born every year

What would happen to the population of snakes and rabbits if hawks were removed from the ecosystem?

Answers

There would be a HUGE increase to their species, because their predator would be gone. And the snakes and rabbits pray would have a huge decrease because there would be more snakes and rabbits that would eat them.

how many gender are really there? I believe that there are two male and female but people say that there are like 50

Answers

Ehhhhh i think 2 but IM NOT REPUBLICAN

I, and certain humans, not only think or believe but KNOW that there are only two. The end.

PBS Evolution: Great Transformations

1. If the world’s history were compressed into one hour, how long have humans been here?

Microbes. Single-celled organisms


2. How long ago did mammals first appear on earth?

Mammals first appeared about 200 million years ago

3. What type of animal did the skull that Dr. Gingrich discovered resemble?

Dr. Gingrich discovered resembled a whale

4. What did "Whale Valley" used to be?

Whale valley is a


5. What unusual feature did they find at the end of the early tetrapods’ limbs?


6. How long ago did animals first appear on Earth?


7. When the mouse "eyeless" gene was implanted into the fruit flies, what happened?


8. How would walking on two legs be an advantage?


9. What modifications does the human skeleton have?

Humans has the same transformation as other animals even though humans are special.


10. Summary/reflection:

Answers

Given that whales and other mammals resembled other mammals in terms of their skulls and other sculptures, based on the fossil evidence, humans have undergone evolutionary transitions.

The transition from land animals to whales is one of the most well-known instances of a supposed change cited by the evolution contingency in the opening of the program. The fossils of Pakicetus, Ambulocetus, Rhodocetus, Dorontid, and Basilosaurus show that this transition can be explained. Pakicetus only has a small portion of its cranium to display, as opposed to a whole transitional fossil.

The program portrays Ambulocetus as a fully preserved fossil of an aquatic mammal with legs, yet this is a stretch of the fact because the animal's skeleton was actually discovered to be extremely fragmented. Rhodocetus is solely represented in the series by a skull.

To know more about evolution, refer to the following link:

https://brainly.com/question/27748371

#SPJ4

Why isn't glycolysis considered a closed pathway?

Answers

Glycolysis is not considered a closed pathway because it consumes energy in the form of adenosine triphosphate (ATP) and generates energy in the form of adenosine diphosphate (ADP) and a high-energy phosphate group. Additionally, the intermediates of glycolysis, such as glucose and pyruvate, can be used in other metabolic pathways.

Which two statements describe force?​

Answers

Answer:

b........................

What specific host gene functions would you consider as strong candidates for such methylation by infecting viruses

Answers

Many viruses specifically methylate genes associated with the immune response, thus dampening that response and enhancing viral infectivity.

What are genes and what do they do?

A gene is the most fundamental physical and functional element of heredity. DNA is the building block of genes. Some genes serve as blueprints for the creation of proteins. Many genes, however, do not code for proteins. Genes in humans range in size from a few hundred DNA bases to over 2 million bases.

What are the four primary roles of genes?

Gene functions include:

Genes are genetic material components and consequently units of heredity.They have control over an individual's morphology or phenotype.Gene replication is required for cell division.Hereditary information is passed down through generations via genes.

Learn more about  gene functions to visit this link

https://brainly.com/question/8334911

#SPJ4

Full Question: What specific host gene functions would you consider as strong candidates for such methylation by infecting viruses?

Many viruses specifically methylate genes associated with the immune response, thus dampening that response and enhancing viral infectivity.

Many viruses specifically methylate protective genes, thus enhancing viral infectivity.

Many viruses specifically methylate genes associated with the cell cycle, thus activating DNA amplification and enhancing viral infectivity.

Many viruses specifically methylate genes associated with apoptosis, thus dampening that response and enhancing viral infectivity.

can some one help me ill give more points if its right. ill give like 50

Answers

Answer:Pollution enters the Earth's atmosphere in many different ways. Most air pollution is created by people, taking the form of emissions from factories, cars, planes, or aerosol cans. ... Some types of air pollution, such as smoke from wildfires or ash from volcanoes, occur naturally. These are called natural sources.

Explanation: Make sure you subscribe to my channell if you like imvu its meiyanna calloway

Answer:

Acid rain is caused by a chemical reaction that begins when compounds like sulfur dioxide and nitrogen oxides are released into the air. These substances can rise very high into the atmosphere, where they mix and react with water, oxygen, and other chemicals to form more acidic pollutants, known as acid rain.

Explanation:

Acid rain that seeps into the ground can dissolve nutrients, such as magnesium and calcium, that trees need to be healthy. Acid rain also causes aluminum to be released into the soil, which makes it difficult for trees to take up water.

Which of the following is true of biogeochemical cycles?

Answers

Explanation:

The carbon, oxygen, and nitrogen cycles are all biogeochemical cycles. They show the movement of elements through living and nonliving components of the Earth. Carbon, oxygen, and nitrogen, are essential components of life that pass through organisms and nonliving components, but are never used up.

8. The table below shows the number of generations required to produce white
butterflies through natural selection Calculate the mean, or average, number
of generations it takes to produce white butterflies.

Answers

Answer:

mean is  44.8

median is 36

Range is 32

Explanation:

hope it helps  

stay safe love u

btw can i get brainliest

The human genome project was able to map the human genome and it is now
completed. Why is this important in science?

Answers

Answer:

What is the Human Genome Project? The Human Genome Project was the international research effort to determine the DNA sequence of the entire human genome. In 2003, an accurate and complete human genome sequence was finished two years ahead of schedule and at a cost less than the original estimated budget.

Explanation:

The finished sequence produced by the Human Genome Project covers about 99 percent of the human genome's gene-containing regions, and it has been sequenced to an accuracy of 99.99 percent.

I need someone to explain this

Answers

it would be carbon dioxide and oxygen. the carbon dioxide is exhaled by the human and then the plant takes it in. the plant exhales the oxygen and the human inhales it. and it continues in a circle over and over.

What was the most significant conclusion that Mendel?

Answers

The most significant conclusion that Mendel drew from his experiments is that 'Traits are inherited in discrete units one from each parent'.

The main conclusion that Mendel drew from his experiments is that traits are inherited from each parent in his individual units and are not the result of interbreeding. He called these separate substantive factors pairs.

Mendel's main conclusion, drawn from his experiments with peas, is that factors are inherited as discrete units and do not exhibit mixing.

The peas he used in his experiments were a good choice because of their distinct contrasting traits, hermaphrodite flowers, short lifespan, and less variation in results with crosses.All monohybrid and dihybrid crosses he considered phenotypic and genotypic ratios were identical.

Genes are now discovered to be pieces of DNA that reside on chromosomes, but Mendel did not know which genes (Mendelian factors) consisted. A study of chromosome behavior was carried out by Sutton and Boveri with the aid of a microscope. They later compared it to the behavior of factors and genes.

For more information on Mendel's experiment , visit :

https://brainly.com/question/30097040

#SPJ4

Complete question :

What was the most significant conclusion that Mendel drew from his experiments?

A There is considerable genetic variation in garden pea

B Traits are inherited in discrete units one from each parent

C Genes are composed of DNA

D Recessive genes occur as frequently as dominant ones.

how dors raising the temperature affect the rate of nuclear decay

HELP ASAP DYE TMRRW

Answers

Unlike chemical reaction rates, which vary with the conditions of a reaction, nuclear decay rates are constant..Raising the temperature has no effect on the rate of nuclear decay.

How does temperature impact the rate of decay?

Decomposing organisms are less active in cooler temperatures, keeping the pace of decomposition low.

How is nuclear decay influenced by temperature?

A speed of alpha, beta, & electron decays all rely on temperature & whether they are contained inside an insulating or conducting material, as demonstrated by numerous groups.

To know more about nuclear decay visit:

https://brainly.com/question/12224278

#SPJ1

Choose all the answers that apply. Biomass includes _____. plants animals animal waste sunlight paper trash

Answers

Biomass includes plants, animals, animal waste, paper products, and trash. It can be used to generate electricity, heat, biogas, and biodiesel.

Plants are a significant source of biomass. Growing crops such as corn, wheat, and soybeans can be used to create energy in the form of ethanol, biogas, and biodiesel. The plant matter can also be burned to produce heat or electricity.

Animals are also a source of biomass. Animal manure can be used to generate biogas, which can be used to run engines or generate electricity. Animal fats and oils can also be used as biodiesel, or converted into biogas.

Animal waste is another form of biomass. Manure, animal carcasses, and other organic materials can be broken down and used to generate biogas. Animal waste can also be composted to create compost or fertilizer.

Sunlight is not a form of biomass, as it does not contain any organic material. However, it can be used to power solar cells and photovoltaic panels, which can be used to generate electricity.

Paper products, such as newspaper and cardboard, can be recycled and used to create biomass energy. This is done by breaking down paper into small, fine particles and then burning it to create heat or electricity. The paper can also be converted into biogas.

Finally, trash is a form of biomass. Food waste and other organic materials can be broken down and used to generate biogas, which can be used to run engines or generate electricity. Trash can also be burned to create heat or electricity.

Learn more about Biomass at :

https://brainly.com/question/21525417

#SPJ4

Complete question:

1.plants

2.animals

3.animal waste

4.sunlight

5.paper

6.trash

What happens in insertion mutation?

Answers

An insertion mutation changes the DNA sequence by adding one or more nucleotides to the gene.

An insertion is a point mutation in which one or more base pairs is added to a DNA sequence. Point mutations is further divided into silent mutations, missense mutations, and frameshift mutations.

Frameshift mutation is considered as a genetic mutation caused by a deletion or insertion in a DNA sequence. This kind of mutation shifts the way the sequence is read. diseases like cystic fibrosis is a result of frameshift mutation that alters the CFTR gene. The harshness of frameshift mutation is reliant on the number of nucleotides and the position of insertion of nucleotides.

To learn more about mutation , here

brainly.com/question/17130462

#SPJ4

What is the probability that two parents with the genotype AaBb will produce an offspring with the genotype AaBb?

Answers

The probability of parents with the AaBb genotype producing offspring with the genotype AaBb is 4/16. Thus the correct answer is (b) 4/16.

The Punnett square method is used to forecast the prospective offspring from a certain cross based on the gametes of the parents. The parents carefully create the gametes that are arranged in a checkerboard pattern so they can understand all the potential children that can be generated. The likelihood of each prospective offspring can be determined using the checkerboard method. In the cross, there are four gametes produced by each of the two dihybrid parents. As a result, the hybrid has the capacity to produce a total of 16 offspring. Out of the 16 possible combinations, only four types of offspring can have the AaBb genotype.

Parents: AaBb*AaBb

Genotypes: AB   Ab    aB   ab *  AB    Ab   aB   ab

Offspring:   ABAB    ABAb   ABaB   ABab   AbAB   AbAb  AbaB  Abab  aBAB   aBAb   aBaB   aBab   abAB  abAb  abaB  abab

Percentage: AaBb: 4/16

The complete question is:

What is the probability of an AaBb offspring when you cross AaBb x AaBb parents?

a. 1/2

b. 4/16

c. 1/8

d. 1/32

e. 1/4

To learn more about cross between parent genotypes please click on the given link: https://brainly.com/question/26601444

#SPJ4

What implications could this have for this species of slug from an evolutionary standpoint? What potential advantages or disadvantages might this mutation have?

Answers

Positive mutations are essential for evolution to occur. They raise a living thing's chances of surviving or procreating. Deadly mutations can give rise to cancer or genetic diseases.

Are mutations typically detrimental?

While most mutations are beneficial, some can also be dangerous. A dangerous mutation might cause a genetic illness or a cancerous condition. Chromosome-level mutations are still another type. Chromosomes, which are little, threadlike organelles present in the cell nucleus, carry genes.

Why do mutations cause issues?

A variation can make a protein malfunction or not be created at all by altering the gene's instructions for producing it. A variation can impair normal development or result in a disease when it changes a protein that is essential to the organism.

To know more about mutations visit:

https://brainly.com/question/17130462

#SPJ1

How does hypertension cause stroke?

Answers

In hypertension, The arteries that carry oxygen and blood to the brain can burst or become blocked by high blood pressure, resulting in a stroke.

There are many ways that high blood pressure can harm your health. It has the potential to seriously harm vital organs like your eyes, brain, kidneys, and heart. Your arteries may become less elastic as a result of high blood pressure, reducing the flow of blood and oxygen to your heart and resulting in heart disease. A stroke can result in severe impairments of speech, movement, and other fundamental activities. You can also die from a stroke.

Know more about hypertension here: https://brainly.com/question/29799896

#SPJ4

in details the steps for blood clotting in response to an injury

Answers

The process of blood clotting, also known as coagulation, is a complex series of steps that the body undergoes in response to an injury in order to stop bleeding and begin the process of healing. Here are the steps involved in blood clotting:

Vasoconstriction: When an injury occurs, the blood vessels in the affected area constrict, or narrow, to decrease blood flow and reduce bleeding.
Platelet activation: Platelets, which are small, disk-shaped cells found in the blood, become activated and begin to stick to the walls of the damaged blood vessels.
Platelet aggregation: Activated platelets release chemicals that attract more platelets to the site of the injury. These platelets then stick together, or aggregate, to form a plug that helps to stop the bleeding.
Formation of the fibrin mesh: The activated platelets release chemicals that stimulate the production of a protein called fibrin. Fibrin forms a mesh-like structure that helps to hold the platelet plug in place and strengthen the blood clot.
Blood clotting: The combination of the platelet plug and the fibrin mesh forms a blood clot that seals off the damaged blood vessel and stops the bleeding. Clot retraction: Once the blood clot has formed, the platelets in the clot contract, or shrink, to help pull the edges of the damaged blood vessel together and further seal the wound.
Clot dissolution: After the injury has healed, the body begins to dissolve the blood clot. This is done through the action of enzymes called plasminogen activators, which break down the fibrin in the clot.

On irreversible effect of both deforestation and water pollution on the environment is the -
A- extinction of species.
B- thinning of the ozone shield.
C- depletion of the atmospheric carbon dioxide levels.

Answers

I think the answer is:
C
I’m not sure tho

A sea otter is considered very important in
maintaining his ecosystem and food web.
Changes with him will affect the ecosystem
dramatically. A species such as this is called
a(n).
A. keystone species
B. VIP
C. ecosystem king

Answers

The answer would be Key stone species

What is the great red spot on Jupiter
A. Hurricane
B. Thunderstorm
C. Bad Weather
D.Tornado

Answers

b.thunderstorm it has really bad winds and rain
a thunderstorm is the answer

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Answers

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

what is the ratio of 15 minutes to 2 hours​

Answers

Answer:

15mins : 2 hrs

15 mins : 120 mins

1 : 8

Answer:

1:8

Explanation:

Convert 2 hours to minutes:

60*2 = 120 minutes

15/120 = 1:8

Quorum-sensing contributes to the ability of bacterial colonies to congregate into nearly solid masses which act as barriers to effective decontamination and sterilization called:

Answers

Biofilms are formed when bacteria congregate into a nearly solid mass. This occurs when bacteria use quorum sensing to communicate with each other and create pathways for cells to attach to and form a matrix.

The matrix shields the cells from external forces and helps to protect the bacteria from antibiotics, desiccation, and extreme temperatures. Biofilms can form on just about any surface, including medical and surgical instruments, water pipes, and even on the surfaces of plants and animals.

The formation of biofilms makes it difficult to decontaminate and sterilize, since the bacteria are protected within the matrix and can withstand harsh chemicals and extreme temperatures. Biofilms are also highly resistant to antibiotics, making them difficult to eradicate.

To learn more about antibiotics visit:

https://brainly.com/question/10868637

#SPJ4

B)¿Cuál de las siguientes asociaciones entre estructura y función es falsa? A. Médula espinal –apreciación de sensaciones B. Cerebelo –coordinación motora. C. Cerebro –función intelectual. D. Bulbo raquídeo –control de la frecuencia del latido cardíaco. c) ¿Cuál de los siguientes procesos es el resultado de la acción del sistema nervioso parasimpático? A. Dilatación de la pupila. B. Inhibición de la digestión. C. Aceleración de la frecuencia cardiaca. D. Contracción de los bronquios. d) Morfológicamente la neurona consta de: A. Axón, dendritas y cuerpo neuronal. B. Soma, axón y nodos de Ranvier C. Soma y prolongaciones D. Soma y dendritas

Answers

Answer:

B) A. FALSO.  

B. VERDADERO.  

C. VERDADERO.

D. VERDADERO.

c) D. Contracción de los bronquios.

d) A. Axon, dendritas, cuerpo neuronal.

Explanation:

B) A. FALSO. La médula espinal es una estructura tubular larga y delgada, formada por tejido nervioso, que se extiende desde la médula oblonga del tronco cerebral hasta la región lumbar de la columna vertebral. El cerebro junto con la médula espinal forman el sistema nervioso central, y particularmente la médula espinal es la vía para transmitir los mensajes que envía el cerebro al cuerpo y del cuerpo al cerebro. Entonces no se ocupa de la apreciación de sensaciones.

B. VERDADERO. El cerebelo desempeña un papel importante en el control motor pero también puede estar implicado en algunas funciones cognitivas, como el lenguaje así como en el control emocional, la regulación de las respuestas de miedo y placer,. Aunque sus funciones relacionadas con el movimiento son las más importantes.  

C. VERDADERO. El cerebro es la porción mas grande del encéfalo (órgano dentro del cráneo) y está formado por dos hemisferios. También comprende varias estructuras subcorticales, como el hipocampo, los ganglios basales y el bulbo olfativo. Es la región más grande del sistema nervioso central y sus funciones incluyen la iniciación y coordinación del movimiento, tacto, visión, oído, regulación de la temperatura, el razonamiento, las emociones, aprendizaje, etc.

D. VERDADERO. La médula oblonga o bulbo raquídeo es una larga estructura en forma de tallo que constituye la parte inferior del tronco encefálico. Se encarga de conectar al cerebro con la médula espinal, y es responsable de varias funciones del sistema nervioso autónomo que incluyen el control de la ventilación a través de señales procedentes de los cuerpos carotídeos y aórticos como también el control cardiovascular al regular los latidos cardíacos. Aunque también está relacionado con otras funciones tales como la tos, estornudo, reflejos del vómito y la deglución.

c) El sistema nervioso parasimpático (SNP) es una de las tres divisiones del sistema nervioso autónomo, siendo las otras el sistema nervioso simpático y el sistema nervioso entérico. El sistema nervioso autónomo se encarga de regular las acciones inconscientes del cuerpo, en donde el sistema parasimpático es responsable de la estimulación de las actividades de "descanso y digestión" cuando el cuerpo está en reposo, especialmente después de comer. Controla por ejemplo, la salivación, el lagrimeo, la micción, la digestión y la defecación. Su acción se describe como complementaria a la del sistema nervioso simpático, responsable de estimular las actividades asociadas a la respuesta de "lucha o huida". Entonces los procesos que son resultado de la acción del sistema nervioso parasimpático son:

D. Contracción de los bronquios. El SNP controla órganos en situaciones o momentos que requieren una respuesta rápida.

d) Una neurona o célula nerviosa es una célula eléctricamente excitable que se comunica con otras células a través de conexiones especializadas llamadas sinapsis. La misma consta de:

A. Axon (proyección larga y delgada de una célula nerviosa que conduce impulsos eléctricos conocidos como potenciales de acción), dendritas (extensiones protoplásmicas ramificadas de una célula nerviosa que propagan la estimulación electroquímica recibida de otras células neuronales al cuerpo celular), cuerpo neuronal (o soma, es la parte bulbosa de una neurona que contiene el núcleo celular)

A DNA s
equence has mutated from

AAG G
CA TTC
-
t
o the sequence of

AAG GCT ATT C
-
. This mutation is an
example of a/an ___________________?
a.
Frameshift mutation
b.
Point
mutation
c.
Triple shift mutation
d.
Chromosomal
mutation

Answers

Answer:

Explanation:

The mutation is from AAG GCA TTC to AAG GCT ATTC

So there is a frameshift with an insertion of a T

Answer is a Frameshift mutation.

Answer:

Explanation:

its an example of single insertion leading to a frameshift mutation

Other Questions
As an estimation we are told 5 miles is 8 km.Convert 52 km to miles. Select all that apply.Which of the following skills are important for job interviews?thinkingwritinglisteningspeakingAnswer : Select all got 100% on edge 4. Why must the people in the annex remain silentduring the day?(1 Point)There is concern that Nazi soldiers mighthear them.Anne, Margot, and Peter need quiet in orderto studyAny noise might reveal that they are in thebuilding.Mr. Frank wants them to be able to listen forintruders. Because of the Doppler effect, a light- or sound-emitting object moving toward you has a ________ compared to a stationary object. Which of the lines whose equations are given below is perpendicular to 3x - 12y = 10? Hello what is the answer please 5+3010= What is the smallest multiple of 6 greater than 115? Can any spanish speakers help me with this?? You have $1000 to invest in two different accounts. In order to save the money you need for college, you need to average 6.6 percent interest. If the two accounts pay 5 percent and 7 percent interest, how much should you invest in each account?A) $800 in 5%, $200 in 7%b) $400 in 5%, $600 in 7%C) $200 in 5%, $800 in 7%D) $500 in 5%, $500 in 7% 1.Which statement do you agree with more?..We have made no progress and we have a huge amount of work left to do. There is no racial equality in thiscountryWe have made some progress, but we still have a lot of work left to do. There is some racial equality in thiscountry, but nowhere near enoughWe have made very good progress, but we still have a little work to do. There is mostly racial equality in thiscountryWe have come all the way and achieved complete racial equality in our country and we have no work left to do.. Which measurements could create more than one triangle?A. A triangle with angles measuring 50 and 80 and an included sidemeasuring 6 inchesB. A triangle with sides measuring 6 inches, 10 inches, and 14 inchesC. A triangle with sides measuring 7 inches, 10 inches, and 20 inchesD. A triangle with sides measuring 18 mm and 21 mm and anonincluded angle measuring 55 El profesor tema que Uds. no.(prestar) atencin. Based on voter turnout statistics, it is clear that many peoplea. believe voting is too time consuming.b. have never voted.c. find voting for President more important than voting for members of Congress.d. tend to vote in off-year elections if the ballot is not too long. Why can the temperature of land, air and water differ? the method "someOtherMethod" is NOT defined as static. This means...1) the method is an accessor method2) the method is accessible outside SomeClass3) the method is not accessible outside SomeClass4) the method is accessible without instantiating a SomeClass object5) the method is accessible only by using a previously instantiated SomeClass objectpublic class SomeClass{ public static final int VALUE1 = 30; public static int value2 = 10; private int value3 = 5; private double value4 = 3.14; public static void someMethod() { // implementation not shown } public void someOtherMethod() { // implementation not shown }} In the basketball experiment, what doesthe different materials represent?Control variable? dependent variable? independent variable? Wilbur ran 1-kilometer. Then he ran 500 meters. How many meters did Wilbur run all together?A) 15,000B) 1,500C) 1000D) 150 Who are the sisters Malala describes? What challenges do the sisters face? Support your answer with text evidence PLEASE HURRY Give examples of some different career opportunities in state, county, and local government.Describe three careers and explain what they do. Tell whether or not you would considerworking for the government and why or why not. . Three subtracted from 2 times a number equals 15. What is the number?