was a drought for a long period of time, what beak type would become more common in the ground finch population explain
Answers
One would anticipate a shift in the population of ground finches toward smaller, more pointed beaks in the event of a protracted drought.
What is population?Population is a term used to refer to a group of individuals, typically humans, that inhabit a particular area or territory.
This is due to the likelihood that there will be less food available during a drought, especially small, hard seeds. Because they are more adept at breaking open tiny, difficult seeds, birds with smaller, quite pointed beaks seem to be better able to take advantage of the scarce food sources that are available. They would have an edge over birds with bigger, blunter beaks in terms of survival as a result. Natural selection would then favour birds with smaller beaks over time, increasing the proportion of birds with the this beak type in the population.
To learn more about population
https://brainly.com/question/29885712
#SPJ1
Related Questions
List all the possible genotypes of the offspring from your Punnett
square in question 4. Next to each genotype write the corresponding
phenotype---short stems or tall stems.
Answers
we see that there are three possible genotypes that could result from this crossing: AA, Aa, aa. The genotypes AA and Aa will result in the yellow pea phenotype because A is dominant. Only aa will produce the green pea phenotype.
A Punnett square is a graph that makes it simple to ascertain the anticipated proportion of various genotypes in children of two parents. Figure below illustrates a Punnett square for pea plants. In this instance, flowercolor is heterozygous for both parents (Bb). The top of the graph represents the gametes produced by the male parent, while the sides represent the gametes produced by the female parent. By correctly filling in the Punnett square's cells, we may identify the various possible allele combinations in their progeny (alleles).
To learn more about Punnett square please visit here:
https://brainly.com/question/27984422
#SPJ4
Conventional CPR provides 15% of normal blood flow to the heart and blood flow to the brain is 25% of normal. The Res Q Pod is an impedance device that prevents unnecessary air from entering the chest during the compression phase of CPR. When air is prevented from rushing into the lungs as the chest wall recoils, the vacuum (negative pressure) in the thorax pulls more blood back to the heart, resulting in:
Answers
The Res Q POD ITD lowers intrathoracic stress at some point of the draw back segment of CPR with the aid of using selectively limiting pointless airflow into the chest.
This vacuum will increase preload, lowers intracranial stress (ICP), and improves blood go with the drift to the mind and crucial organs. Compress the ResQPUMP towards a clean difficult floor with about 50 kg of pressure, the use of the pressure gauge at the ResQPUMP as a guide. Observe for an growing gauge reading. 3. Pull up at the deal with with about 10 to fifteen kg of pressure, the use of the decompression pressure gauge as a guide. The CPR remarks gadgets permit to screen the best of resuscitation and tell the rescuer approximately the fundamental parameters of the guide chest compressions being performed, consisting of chest compression price and depth, and complete chest recoil.
To learn more about CPR check the link below:
https://brainly.com/question/3725035
#SPJ4
Ue evidence from model to contruct an explanation about how carbon can form chain and ring tructure in biomolecule and how boimolecule are ued in cell procee
Answers
Biomolecules are used in cells to build cells and provide energy to cells.
Living organisms are built from the element carbon which has a mass of more than half the dry mass of their cells. Elemental carbon can form single bonds with hydrogen atoms, and double bonds with oxygen atoms or nitrogen atoms. The carbon atom is special because of its ability to form very stable bonds with other carbon atoms so that it can form very large molecules. Two carbon atoms can also be bonded together to form a double or triple bond.
Most biomolecules can be viewed as derivatives of carbonates, a group of compounds consisting only of the elements carbon and hydrogen, by replacing one or several hydrogen atoms with certain functional groups, resulting in various groups of carbon compounds with distinctive properties.
Learn more about biomolecule at https://brainly.com/question/10904629
#SPJ4
Explain how the structure and function of the smooth muscle, skeletal muscle and cardiac muscle is required for its function in the body.
Answers
Answer:
Cardiac and skeletal muscle are both striated in appearance, while smooth muscle is not. Both cardiac and smooth muscle are involuntary while skeletal muscle is voluntary. ... Cardiac muscle is also an involuntary muscle but is more akin in structure to skeletal muscle, and is found only in the heart.
Can soneone please explain enzymes in a clear and in an understandable way?
Answers
Enzymes are biological catalysts* and enzymes are also a protein
Catalysts* are a substance that can speed up reactions
Using a microscope, you observe an amoeba moving toward a food source. This is an example of
A) reproduction.
B) cellular structure.
C) metabolism.
D) growth.
E) responsiveness.
Answers
The act of recognizing changes with one's internal or external environment and responding to any of those changes is known as response time, sometimes known at responsiveness or irritability. It consists of sensing a stimulus and responding to it.
What is meant by "responsiveness"?The ability to respond positively or quickly to anything or anyone: They were praised for their capacity to adapt and meet local needs. She doesn't pay much attention to her surroundings.
Why is being responsive so important? It is what?Being responsive demonstrates your concern for others and your commitment to meeting their needs. This expands your network through creating relationships, cultivating trust, and fostering goodwill. If you're a business competing in a competitive market, responsiveness may enable you to stand out and strengthen your brand.
To know about more responsiveness visit:
brainly.com/question/10025293
#SPJ4
8. In a deletion mutation a base my be
C. Moved
A. Left out
B. added in
Answers
Answer:
LEFT OUT
hope it help
Please place answers under questions so I know which is which. Thank you! :)
What products are made in light-dependent reactions (photosynthesis)?
What products are made in light-independent reactions (photosynthesis)?
Products: ADP, ATP, NADPH, NADP+, Oxygen, Sugars
Answers
The products of the light-dependent reactions are= ATP, NADPH, and O2, and the products of light-independent reactions are= Sugars, ADP, and NADP+.
Photosynthesis has two parts: one is light-dependent and another one is a light-independent reaction (also known as-Calvin cycle). The process is vice versa, where few inputs of the light-dependent reaction are used to make the outputs for the light-independent reaction, and few inputs of the light-independent reaction are used to make the outputs for the light-dependent reaction.
The goal of a light-dependent reaction is to convert light energy into chemical energy. And the location of light-independent reaction is at Chloroplasts—stroma.
To know more about the products of such reactions, refer to:
https://brainly.com/question/1447677
While both the endocrine and nervous systems are involved with communication, they differ in their mechanisms. What is one difference between hormones of the endocrine system and neurotransmitters of the nervous system
Answers
Answer:
Hormones are released by the glands in the endocrine system and are transmitted into the bloodstream..while neurotransmitters are released by the presynaptic terminal in the synapse and are transmitted across the synaptic cleft....
I hope this helps
Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA
Answers
ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA edits the DNA of the first codon to AAA, so it changes to AAA CCG GGC GGC GAG AGC TTG CTA ATT GGC TTA TAA, so its complementary sequence is TTT GGC CCG CCG CTC TCG AAC.
What is DNA?Every cell's DNA contains information that is transformed into brief, portable RNA messages during transcription.
The fact that DNA is in charge of the process known as the protein synthesis method by which cells produce proteins is another highly significant function of DNA.
Therefore, DNA dictates the structure and function of your proteins, every component of your body, including your fingernails, eyes, and many other things are comprised of proteins.
Learn more about DNA, here:
https://brainly.com/question/21992450
#SPJ1
What is the probability that a baby born to a man and woman both carriers for the recessive albino gene will be an albino?
Answers
If both parents have the gene, their child has a 1 in 4 chance of having inheritance albinism and a 1 in 2 chance of having the gene. Although they do not have albinism, carriers can pass the gene on.
One type of inheritance pattern for a trait, sickness, or problem that is passed down through families is autosomal recessive characteristics. There must be two copies of a recessive trait or disease for it to manifest. The gene or characteristic will reside on a non-sex chromosome. As a trait requires two copies to develop, many people may unintentionally carry a disease. A recessive illness or characteristic may go unnoticed for a few of generations before manifesting as the phenotypic, according to evolutionary theory. Diseases that are autosomal recessive include albinism and cystic fibrosis.
To learn more about inheritance click on the given link: https://brainly.com/question/14930526
#SPJ4
Which of the following is an example of one stage in ecological succession?
A. A tree falls over in a forest.
B. Weeds grow in a garden.
C. Fish swim in a pond.
D. A bird lays eggs in a nest.
Answers
What happens after point A in regard to the population and resources available at that point in time?
Answers
At Point A, population and resources are consistent with each other. This meant at the time, that populace had access to sufficient resources.
Natural resources are anything that can be obtained from the environment for human needs. The more the population increases, the more natural resources are used to meet needs.
For example, food, clean water, clean air, and other needs. If the population increases, various problems will arise, for example, traffic flow density which causes air pollution, many agricultural lands being used as residential areas resulting in slums, and finally clean water becomes a problem. The more the population, the fewer natural resources will be eaten.
The complete question is seen in the picture
Learn more about the population and resources at https://brainly.com/question/24067944
#SPJ4
In community ecology we discussed the four main types of Interspecific Interactions. Select the correct answer(s): Group of answer choices Two possible outcomes of competition are resource partitioning and extinction Some bacteria use specialized metabolites (e.g., antibiotics, siderophores) to compete more effectively. Predation has a small impact on microbial community composition in oceans The production/release of antagonistic factors (e.g., lytic compound) to impede competitors is an example of exploitation competition
Answers
Answer:
Two possible outcomes of competition are resource partitioning and extinction.
Explanation:
Community ecology is the association of two or more population of different species that occupy the same geographical area within the same time and thus the term studies the interaction that takes place between the species in temporal and spatial scale.Why are there not large, visible colonies of bacteria like those in the petri dish on the things we use every day?
(please don't write anything randomly or else I will report your account for nonsense)
Answers
Answer: most likely because there is constant air flow around us most of the time. It also depends on what materials are around us and the moisture level. For example, most bacteria cannot grow on metals, especially copper because of the way it’s composed.
Explanation:
what is binomial nomenclature. please help ASAP
Answers
binomial nomenclature definition
Explanation:
the system of nomenclature in which two terms are used to denote a species of living organism, the first one indicating the genus and the second the specific epithet.
Answer:
the system of nomenclature in which two terms are used to denote a species of living organism, the first one indicating the genus and the second the specific epithet.
Substance Y is not present in the urine; however, it was originally filtered through the glomerulus. How is this possible
Answers
Substance Y is not present in the urine; however, it was originally filtered through the glomerulus it was reabsorbed in the proximal tubule.
As blood flows into every nephron, it enters a cluster of tiny blood vessel, the glomerulus. The skinny partitions of the glomerulus permit smaller molecules, wastes, and fluid—often water, into the tubule. Larger molecules, together with proteins and blood cells, live withinside the blood vessel. Under ordinary conditions, excessive molecular weight proteins withinside the plasma (e.g., albumin and globulin) can't skip via the filtration membrane because of the results of the scale barrier and rate barrier of the glomerular capillary filtration membrane. Proteins are not normal constituents of the glomerular filtrate.
To learn more glomerulus check the link below:
https://brainly.com/question/7175191
#SPJ4
What food chain is a snail?
Answers
Snails are the part of the grazing food chain where they belong to the category of primary consumers.
Food chain is a hierarchical series of energy transfer where one organism feeds upon the lower one to gain energy. There are two main types of food chains: grazing food chain and the detrital food chain. The grazing food chain starts with the autotrophs whereas the grazing food chain begins with the dead and decaying organic matter.
Consumers are the animals that depend on other organisms for their food and energy source. Consumers can be of three types: herbivores, carnivores and omnivores.
To know more about consumers, here
brainly.com/question/2676728
#SPJ4
What is the best example of a Mendelian trait in humans?
Answers
The best example of a Mendelian trait in humans is phenylketonuria. This illness is an illustration of a Mendelian trait since it is passed down from parents to children when both parents have heterozygous (Aa) and homozygous (Aa) circumstances.
Mendelian qualities are determined by all of Mendel's postulated Laws of Inheritance and are traits that are transferred from parents to children through dominant and recessive alleles of a gene. The lack of an enzyme that turns the amino acid phenylalanine into tyrosine is the root cause of the autosomal recessive inherited disorder. As a result, the amino acid builds up and is converted into the toxic form of phenyl pyruvic acid, which builds up in the brain of the person and causes r-e-t-a-r-d-a-t-i-o-n.
To know more about Mendelian traits please visit
https://brainly.com/question/29754443
#SPJ4
How can a cup of water decrease in temperature? please answer my question in a scientific method, the questions will be below.
Step 1: Observation
Step 2: Research:
Step 3: Hypothesis:
Step 4: Experiment – explain the experiment that you would perform
Step 4a- The control variable
Step 4b- The dependent variable
Step 4c- The independent variable
Step 5- What do you predict the conclusion to be?
Answers
The first step for this experiment is observation where it is found that a cup of water decreases in temperature. The rest of the steps are described in the explanation part.
What is a Scientific method?A scientific method may be characterized as the process of objectively establishing facts through testing and experimentation. The basic process involves making an observation, forming a hypothesis, making a prediction, conducting an experiment, and finally analyzing the results.
The second step is research in which a cup of water is placed at different temperatures where it can easily change its state from liquid to solid. The hypothesis governs that the amount of water in a cup may lower or decreases when it is exposed to several temperatures.
The experiment is performed on the basis of certain evidence and assumptions in order to predict some conclusion. The control variable is the influence of temperature. The dependent variable is the amount of water and the independent variable is the exposure to temperature.
Therefore, it is concluded that a cup of water decreases in temperature.
To learn more about the Scientific method, refer to the link:
https://brainly.com/question/497944
#SPJ1
How does folding dough help it to rise
Answers
folding dough increases the air trapped between the layers which cause it to rise
Which of the following statements best explains differences between the finches?
A. Some finches were born with beaks that allowed them to have better access to different sources of food. These finches reproduced and passed on their genes.
B. The beaks of the finches changed so all of the finches could eat the same types of food.
C. The beaks of the finches changed as the species of finches migrated to the same island.
D. The beaks of the finches changed as the finches' body sizes changed.
Answers
Answer:
i think it's D I hope this helps :)
Answer:
D is the answer
Explanation:
How can katey and amanda's amino acid sequence be the same and yet they may have a differences in their DNA?
Answers
Answer: Two people can have different DNA sequences but these sequences can code for the same amino acids due to the redundancy of the genetic code in which two different codons can code for the same amino acid.
Explanation:
The genome of an organism is found in a molecule called DNA (deoxyribonucleic acid). The main function of this DNA molecule is the long-term storage of information to build other components of cells, such as proteins and RNA molecules (ribonucleic acid); and the portion of the genome that codes for a protein or RNA is known as a gene. These protein-coding genes are composed of trinucleotide units called codons, each of which codes for an amino acid. For a protein whose sequence is encoded in the nucleotides of DNA to be synthesized, that DNA molecule must first be transcribed into a molecule called messenger RNA, and this molecule is used for a process called translation or protein synthesis. The sequence of the genetic material is composed of four distinct nitrogenous bases, which are represented by letters in the genetic code:
Adenine (A)Thymine (T)Guanine (G) Cytosine (C)Uracil (U) instead of T in RNAThe genetic code is the set of rules that defines how a sequence of nucleotides in RNA is translated into a sequence of amino acids in a protein. This code is common to all living things, which shows that it has had a unique origin and is universal. So, the code defines the relationship between each sequence of three nucleotides (codon) and each amino acid. The number of possible codons is 64, of which 61 code for amino acids (one of them being the start codon, AUG) and the remaining three are stop sites (UAA, UAG, UGA). The codon sequence determines the amino acid sequence in a particular protein, which will have a specific structure and function.
However, the genetic code has redundancy but no ambiguity. For example, two different codon can code for the same amino acid, and the differences between codons encoding the same amino acid have differences in the third position. This is explained by the wobble effect, where the same anticodon (present in the transfer RNA that loads with the amino acid and interacts with the codon in the messenger RNA) can establish interaction with different codons, which differ in their third base. This is why, in general, tolerance to change at this position is greater than at the first and second positions, and therefore tends to be less represented in the case of variations that result in pathologies.
Thus, two people can have different DNA sequences but these sequences can code for the same amino acids due to the redundancy of the genetic code in which two different codons can code for the same amino acid.
HELP PLEASE!!!! growing on
With secondary
Primary succession begins with plants like
succession is already present.
lichens...bare rock...soil
moss...soil...a habitat
dandelions...bare rock...a habitat
palm trees...soil...an animal
Answers
Answer: Is A
Explanation:
Lichens break down rock from there the soil start to create life i don't how to explain it
5. Kimberly draws the food web shown. A reduction in the population of which organism
would reduce the food sources available to all of the other organisms? (1 point)
Answers
Answer: Krill
Explanation:
Tha basis for energy of the animals is krill - so reduction in its population would influence all organisms.
_________ refers to a pea plant that is either homozygous dominant or homozygous recessive for a particular trait.
Answers
Answer:
A purebred.
Explanation:
A purebred is an animal or plant that carries two identical alleles for a particular gene or trait. This means that if the pea plant is homozygous dominant (has two of the same dominant alleles), or homozygous recessive (has two of the same recessive alleles), it is considered a purebred. A purebred always expresses only one form of the trait.
A heterozygous purple flowered plants is crossed with one that is while.
Answers
Explanation:
A = Purple
a = white
Aa/AA - purple
aa - white
What happens to the light when you look at a green object?
Answers
When you look at a green object, the object reflects green light and absorbs other colors of the visible spectrum. The green light is then transmitted to your eye, where it is focused by the lens onto the retina.
The retina contains specialized cells called rods and cones that are sensitive to different wavelengths of light. The cones in the retina are responsible for color vision and are most sensitive to different colors in the visible spectrum, and when the green light reaches the cones, it triggers a neural signal that is sent to the brain, where it is interpreted as the color green. The absorbed light colors are not reflected and are green absorbed by the object, they are not transmitted to green the eye, so they are not perceived by the observer.
Learn more about light here:
https://brainly.com/question/8181719
#SPJ4
Which blood type can be donated to the largest percentage of individuals?
Answers
Answer:
Type O+
Explanation:
What causes populations to lose genetic diversity due to chance?
Answers
Stochastic sampling error (i.e., genetic drift) causes populations to lose genetic diversity due to chance.
Genetic drift is a result of sampling error because individuals are randomly chosen when a population is sampled. A random selection is one in which each member of the population has an equal chance of being chosen.
The random change in allele frequencies caused by stochastic sampling of alleles from the previous generation is known as genetic drift (independent of demographic stochasticity).
The variety of various inherited features within a species is referred to as genetic diversity. There would be many people with a wide range of diverse traits in a species with significant genetic diversity. For a population to adapt to changing surroundings, genetic variety is essential.
To learn more about Genetic diversity :
https://brainly.com/question/14926046
#SPJ4