What states voted to secede in April, 1861?

Answers

Answer 1
virginia, north carolina, tennessee, arkansas, south carolina, mississippi, florida, alabama, georgia, louisiana and texas all seceded by april 1861

Related Questions

why was the virginia house of burgesses considered a representative government

Answers

Answer:

Because they ran in the same way, people would vote county officials that would meet in the house of burgesses, there for its representative

Explanation:

What land did Spain give up to Great Britain in the Treaty of Paris?
a.
Canada
b.
land east of the Mississippi River
c.
Texas
d.
Florida


I NEED HELP

Answers

Answer:

B

Explanation:

Canada remained french

Texas was from mexico

Florida was from spain

Which of the following best describes the Aztec Empire before it was conquered?
a. a large, complex civilization

b. a large, primitive civilization

c. a small, complex civilization

d. a small, primitive civilization

Answers

Answer:

A. a large, complex civilization

A is the answer to this

what is characteristic of george greenville

Answers

The Answer is Virgin

How does the Spanish inquisition connect to the reformation and the renaissance?

Answers

Answer:

The Spanish inquisition played a vital role in giving power to the monarch.

Explanation:

The church remained a vital source of income for the Spanish crown. Fercia reales given to the Crown of Castile and it constituted the tithes collected by the church in this region. One of the great powers enjoyed by the Spanish rulers related to the Inquisition. It became a vital instrument for the expansion of the state power given by Pope Sixtus IV in 1478 to the Spanish monarch. Orthodox Christianity was the only real basis for the strong kingdom according to the Spanish monarchs.

Instability and violence between feuding warlords in the 1990s made Somalia an example of a(n) __________.

Answers

Answer: anarchy

Explanation: In the 1990’s this was a way in which it was ruled in an anarchy way. Usually leading to instability and violence between these warlords

when did alcatraz cloused

Answers

March 21, 1963

I hope that answer helps, enjoy your day.

What is a corporation?

A)company with one owner
B)company with two or three owners
C)company that is very large d)controlled by one person
company with investors

WILL GIVE BRAINLEIEST!!

Answers

company with investors

why should the British government give the rosetta stone back to Egypt

Answers

Answer:Speaking in 2003, when his campaign began, Dr Hawass said: "If the British want to be remembered, if they want to restore their reputation, they should volunteer to return the Rosetta Stone because it is the icon of our Egyptian identity." The archaeologist, who has established a fearsome reputation as the self- ...

Explanation:

describe what happened in the election of 1912

Answers

Answer:

Democratic Governor Woodrow Wilson of New Jersey unseated incumbent Republican President William Howard Taft and defeated former President Theodore Roosevelt, who ran under the banner of the new Progressive or "Bull Moose" Party.

Explanation:

The Soviet leader that caused the fall of the Soviet Union was?​

Answers

Answer:

Mikhail Gorbachev

Explanation:

Answer:

Mikhail Gorbachev

Explanation:

Why were American colonists especially angry with the Tea Act?

Answers

Answer:

The passing of the Tea Act imposed no new taxes on the American colonies. Besides the tax on tea which had been in place since 1767 what fundamentally angered the American colonists about the Tea Act was the British East India Company's government sanctioned monopoly on tea.

Have a good day love! Hope this helped

The Declaration of Independence contains which of the following?
A. A list of grievances (complaints) against the king of England
B. A debate over which powers should be held by the federal or state governments
C. A plan for organizing new territories
D. A draft of the Articles of Confederation

Answers

Answer:

A. A list of grievances (complaints) against the king of England

Explanation:

not only were these grievances against the king of England, but the british government as well. the colonists had been treated unfairly by the king, and eventually all this unfair treatment led to the declaration of independence being born.

What economic changes occurred in Europe as a result of mercantilism and
capitalism?

Answers

Answer:

Mercantilism in Great Britain consisted of the economic position that, in order to increase wealth, its colonies would be the supplier of raw materials and exporter of finished products. Mercantilism brought about many acts against humanity, including slavery and an imbalanced system of trade.

Explanation:

Which region is in Eastem Antarctica?
Transantarctic Mountains
American Highlands
Russian Highlands
American Mountains

Answers

American highlands i think

How did Manifest Destiny mean different things to Americans and immigrants? Why

Answers

Manifest Destiny is a term for the attitude prevalent during the 19th century period of American expansion that the United States not only could, but was destined to, stretch from coast to coast. This attitude helped fuel western settlement, Native American removal and war with Mexico.

Answer:

Manifest Destiny was the belief that that God destined the Americans to move west, for Native Americans this meant that their land was being taken by force. The immigrants that built the transcontinental center railroad were from china and ireland. These immigrants were often injured and died because of the conditions that they were working in.  Also Native Americans were forced to attend the school Carlisle to change their culture and make the more like the whites.

Explanation:

I hope this helped you!!

Slave codes were designed to give enslaved people some rights. protect enslaved people. control enslaved people. grant enslaved people freedom.

Answers

Answer:

protect enslaved people

Explanation:

i looked in my book thingy text number area :3

Answer:

protect enslaved people

Explanation:

i just took the test

What was the doomsday book?

Answers

Answer:

After the Norman invasion and conquest of England in 1066, the Domesday Book was commissioned in December 1085 by order of William The Conqueror. William needed to raise taxes to pay for his army and so a survey was set in motion to assess the wealth and and assets of his subjects throughout the land.

Explanation:

5. How does this document explain how Islam spread so quickly?

Answers

Answer:

Islam spread through military conquest, trade, pilgrimage, and missionaries. Arab Muslim forces conquered vast territories and built imperial structures over time.

Explanation:

Have a Nice day.

over what major issues did bacon and Sir William Berkeley become Fierce opponents?​

Answers

Answer:

c

Explanation:

c

What is the "heart of the French diet"?​

Answers

The “Heart Of A French Diet” is full-fat cheese and yogurt, butter, bread, fresh fruits and vegetables, One of the most popular diets!

from what source does the national government get most of its revenue?

Answers

The three main sources of federal tax revenue are individual income taxes, payroll taxes, and corporate income taxes. Other sources of tax revenue include excise taxes, the estate tax, and other taxes and fees

Which power of congress is used most?

Answers

• Make laws
• Declare war
• raise and provide public money and oversee its proper expenditure
• impeach and try federal officer
• approve presidential appointments
• approve treaties negotiated by the executive branch
• oversight and investigations
Congress has the power to:
Make laws.
Declare war.
Raise and provide public money and oversee its proper expenditure.
Impeach and try federal officers.
Approve presidential appointments.
Approve treaties negotiated by the executive branch.
Oversight and investigations.

How did the colonist react to the First Continental Congress 1774

Answers

Answer:

With its enactment in November, most colonists called for a boycott of British goods, and some organized attacks on the customhouses and homes of tax collectors. After months of protest in the colonies, Parliament voted to repeal the Stamp Act in March 1766.

which statement describes a characteristic of a secondary source

Answers

Answer: historical interpretation of a past event

Explanation:

The Confederate defeat at Vicksburg was important because it...
A.
ended the last major Confederate invasion of the North.
B.
resulted in the Confederacy being split in half along the Mississippi River.
C.
caused Jefferson Davis to resign as president of the Confederacy.
O
o D.
forced Robert E. Lee to leave Virginia and take command in the West.

Answers

Answer:

This is B

Explanation:

I spent a year on this. I promise that this is right.

The head of the Christian Church in Europe is called “the Holy Roman Emperor.”


Please select the best answer from the choices provided

T
F
The answer is true

Answers

Answer:

jni

Explanation:

Answer:

True

Explanation:

T

A state with a large population has...
equal power in the U.S. Senate and the U.S. House of Representatives
more power in the U.S. Senate than in the U.S. House of Representatives
less power in the U.S. Senate than in the U.S. House of Representatives
more Supreme Court justices that come from their state

Answers

Answer:

Less power in the U.S. Senate than in the U.S. House of Representatives

Explanation:

Every state gets two senators in the U.S., regardless of their population. In the House of Representatives, you get more representatives depending on your population. Ex. California has a population 39 million people, which gives them 53 representatives(I don't know the conversion rate). But a state like Wyoming has only 1 representative.

I need help ASAP!! somebody please help!!! Why did Europeans seek to justify their actions even if those actions were negative for Indigenous people?

Answers

Answer:

they needed to get their way, thats why

Explanation:

Which best describes how Christians and Jews were treated under the rule of the Ottoman Empire

a
They were treated as complete equals by Muslims
b
They were forcibly converted to Islam
c
The lived in self-governing communities, which paid special taxes
d
They were expelled to nearby Christian countries in Eastern Europe

Answers

Answer:

A

Explanation: Christians and Jews were protected under "dhimmi" which was a law to protect them.

The best describes how Christians and Jews were treated under the rule of the Ottoman Empire as they lived in self-governing communities, which paid special taxes. (C)

What is rule?

Rule is one of a set of explicit or understood regulations or principles governing conduct within a particular activity or sphere.

What is self-governing?

Self-governing is exercising control over one's own affairs.

What is special tax?

Special tax is a tax levied to fund a particular government project.

To learn more about self-governing and special tax refer

https://brainly.com/question/19226541

#SPJ2

Other Questions
What are machines fueled by?1. Energy 2. Electricity only3. gasoline only4. Sun You measure containers for international shipments. The height of the standard container is 6 feet and 7 inches. What is the height in meters? TIME REMAINING52:45The robotic rover Curiosity has instruments that detect radiation both inside the spacecraft and in the Mars environment. What is most likely the purpose of this radiation detection?to determine whether human exploration of Mars is possibleto develop better X-ray technologyto find evidence of once-living Martian microorganismsto investigate evidence of hydrogen and water (1/3)^2=? I need help with math I'm failing, because of my teacher By finding out who Figaro's parents are how does this inconvenience the Count? Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations factorizar por el motodo de aspas [tex]12x^2 = 3x + 2[/tex] Consider this expression. -3x2- 24x - 36 What expression is equivalent to the given expression?