We are going to the mall tomorrow underline the verb phrase circle the main phrase

Answers

Answer 1

The lexical verb and the principal verb are other names for the main verb. This term refers to the sentence's important verb, which typically reveals the subject's action or state of being.

Main verbs can be used by themselves or in conjunction with a helping verb, also known as an auxiliary verb.

We are going to the mall tomorrow - are is verb.

What is a good illustration of a main verb?

Give a few illustrations of main verbs. Eat, drink, move, talk, have, have had, am, is, take, keep, need, try, and so on, are a few verbs that function as main verbs.

To learn more about conjunction here:

https://brainly.com/question/28839904

#SPJ1


Related Questions

What is the theme of the glove and the lions poem? Put this in the form of a theme statement which is the message from the author, put in the form of a sentence that talks about human nature of life in general. It is never a single word.

Answers

Answer:

The theme of the poem is that even when faced with adversity, courage and determination can lead to success, highlighting the resilience of human nature in the face of life's challenges.

Explanation:

In analysis of literature, the literary perspective is based on___
and the historical perspective is based on ___

Answers

Answer:

Literary Perspective is based on interpretation and Historical Perspective it based on the general and comprehensible structure of the text

Answer: Literature is based on perspective while historical is more critical

Explanation: Literature is based on the analysis of the artistic part of a work. For example themes, symbolism, literature devises etc. Historical perspective is based on grammar, accuracy, information etc.

Which empire in China was one of the largest of its time ?

Give evidence!
••••••••••••

Answers

B) Mongolian empire

Queen Elizabeth’s purpose in this speech is mainly

Answers

Queen Elizabeth’s purpose in this speech is mainly to encourage her subjects to remain united and hopeful despite the difficult times they were facing.

For whom Queen Elizabeth gave her speech?Queen Elizabeth's speech was given to her people across the United Kingdom. She spoke of the difficult times the country was facing, and the need to work together to overcome them. She thanked the medical staff and essential workers for their tireless efforts, and called on the public to continue to follow the advice of the government and stay at home. She also called for unity and resilience, and spoke of the importance of looking out for one another. She spoke of the importance of the NHS, and the need to continue to support the vulnerable and elderly. She reminded her people of their shared history and the strength of their connections. She spoke of the need to come together and focus on the future, and the hope for a brighter tomorrow. Queen Elizabeth’s speech was a reminder of the power of hope and of the strength of the British people in times of adversity.

To learn more about Queen Elizabeth's speech refer to:

https://brainly.com/question/1395812

#SPJ1

In the book Drivers Ed by Caroline Cooney What military branch does Morgan want to join?

Answers

We can see that in the book "Drivers Ed" by Caroline Cooney, the military branch Morgan wants to join is the police.

What is Drivers Ed?

Drivers Ed is actually known to be a story written by Caroline Cooney. Morgan and Remy are eager throughout the narrative. After taking a late-night joyride with an experienced driver, they ultimately steal a stop sign. Remy and Morgan's innocent joke turns deadly, forcing them to disclose a heartbreaking secret. Morgan Campbell had been anticipating turning sixteen and getting his driver's license ever since he could remember. Morgan was so focused on his first romance that he forgot what driving was all about.

The protagonists of the story are the young people Remy and Morgan, whose inescapable romance features a surprising plot twist. The film is set in an ordinary American suburb. We learn from the narrative that Mr. Willit had a school bus and had meant to pair up Remy and Morgan.

Learn more about Drivers Ed on https://brainly.com/question/30180611

#SPJ1

Why did the author of Passage 1 MOST LIKELY choose to use the same underlined words in both lines 8 and 16 of the poem ?

Answers

Answer: d: the repetition supports the overall message of the poem

Explanation: the only one that makes sense

Which of the following accurately represent what Sartre thinks the “human" in "human being" is? Select all that apply.
a subject
a conscious self
a zoological species
m a soul

Answers

Answer:

A subject as each person is used as something to study

A soul, the soul defines a person

If a sentence is a fragment, what is it lacking?

Answers

could be missing a subject, verb, etc

It is missing a subject or it is missing a verb

Question 18 (Mandatory) (2 points) What is a benefit of adding a certification to your resume

Credibility and support to your knowledge

Has no effect

Guarantees you will get a job

Shows you went to a good school

Answers

According to career coach and founder of Career Gina Riley, Certifications are important in that they can give a job applicant confidence and credibility.

What does a certificate of certification serve as its primary function?

Certifications are special qualifications that a person can obtain to demonstrate their reliability and ability to carry out a profession. Your certification is often presented as a document that certifies that, as a professional, you have received the necessary training, education, and preparation to fulfill the requirements of your position.

Do I need to include certificates on my resume?

Put a qualification or license on your resume if it is necessary or desired for the position you are going for. Additionally, "as with other content on your CV, you want to highlight" certificates pertinent to the position you're pursuing, advises Yurovsky.

To know more about certification resume visit:-

https://brainly.com/question/29789674

#SPJ1


Words are said to have real power. Do
you believe that what you say to others or
what others say to you or even what you
say to yourself has any real power?
Explain using examples

Answers

Answer:

Indeed, I consider that words have the power to have a decisive influence, both positively and negatively, on the listener. In other words, the messages that each person transmits have the power to modify the behavior of the receiver, as they can generate a reflection on a particular issue and change their way of thinking. A clear example occurs with religious conversions, where the message from a believer to an atheist ends up modifying the personal convictions of the latter, causing him to modify his behavior.

Which of the words could be used in place of steam disapproved neglect criticize admire

Answers

The word that can be used as a synonym to replace the word "steam" would be C. criticize

What is a Synonym?

This refers to the term that is used to describe and define the words that are nearest in meaning to another word in a given sentence and this can be in a connotative or denotative manner.

Hence, it can be seen that when it comes to the answer choices, the answer is most likely connotative which means it is implied and to steam someone means to criticize them.

Read more about synonyms here:

https://brainly.com/question/76433
#SPJ1

60 points!!!!!
Which phrase best states the author's opinion on assisting children's development?
adapted excerpt from "Some Rights of Children as Persons" in School Education
by Charlotte Mason
A very interesting and Instructive educational experiment on these lines has lately been tried In Hackney, where Mr. Sargent got together some
elghty boys and girls under the conditions of an ordinary elementary school ... The results seem to have been purely delightful; the children
developed an amazing capacity for drawing, perhaps because so soon as they were familiar with the outlines of the flower and foliage of a given
plant, for example, they were encouraged to form designs with these elements. The really beautiful floral designs produced by these girls and
boys, after quite a short art training, would surprise parents whose children have been taught drawing for years with no evident result. These
children developed themselves a great deal on their school magazine also, for which they wrote tales and poems, and essays, not prescribed
work, but self-chosen. The children's thought was stimulated, and they felt they had it in them to say much about a doll's ball, Peter, the school
cat, or whatever other subject struck their fancy. "They felt their feet" as the nurses say of children when they begin to walk; and our
non-success in education is a good deal due to the fact that we carry children through their school work and do not let them feel their feet.

Answers

The phrase that best states the author's opinion is "our non-success in education is a good deal due to the fact that we carry children through their school work"

What is an Opinion?

This refers to the personal viewpoint about something which can either be true or false.

Hence, we can note that the author had an opinion about helping children with their school work and he said that "our non-success in education is a good deal due to the fact that we carry children through their school work"

Read more about opinion here:
https://brainly.com/question/377502

Answer:"our non-success in education is a good deal due to the fact that we carry children through their school work"

what major event occurs in Frankenstein s life when he is 17 years old?

A. His father abandons the family and leaves them penniless
B. He boards a ship for America and almost drowns when it sinks
C. His younger brother leaves home to join the German army
D. Elizabeth contracts scarlet fever and nearly dies​

Answers

It’s either A or C .-. .-.x.x.

1. I wish I _____ gone to the park.
A) has advised
B) have advised
C) had advised
2. Miss Elizabeth _____ to the puppies.
A) has given
B) have given
C) had given


please help me​

Answers

I think it would be 1) c 2) a

When light bends as it passes from one transparent object to another, the light is ________.

Which best completes the statement?

absorbed
reflected
refracted
bounced

Answers

Answer:

Refracted

Explanation:

Refraction is the concept that light bends as it passes from one object to another.

The complete statement is, when light bends as it passes from one transparent object to another, the light is refracted, hence option C is correct.

What is refraction of the light?

Refraction is the term for the bending of light as it passes through transparent materials also occurs with sound, water, and other waves.

We are able to create lens, magnifying glasses, prisms, and rainbows because of this bending caused by refraction. Even our eyes rely on this light bending.

The rainbow is an illustration of refraction. A rainbow is created when atmospheric water droplets refract light rays.

Therefore, when light bends as it passes from one transparent object to another, the light is refracted, hence option C is correct.

Learn more about refraction, here:

https://brainly.com/question/23750645

#SPJ5

heres another one ii need help hurry guyssss !!

Answers

Answer:

d

Explanation:

Here’s a helping hand the answer is D

why did the poet say that we are the casualties of the war​

Answers

Answer:

The poet asserts that the causalties are not only the ones who are dead, for they are far from the devastating consequences of the war. They are not only those who are wounded though they are well on the route to death. They await burial by installments as death is the Ultimate escapism.Sep


What is the rhetorical device used in the last two sentences of paragraph 12
A. hyperbole
B. sarcasm
C. irony
D. litotes
E understatement

Answers

The answer would be C
Your answer would be C. irony

HELP PLEASE!!!
Organize and Develop Your Ideas
Writing Prompt: Read the letter to the editor "I, Too, Have a Dream." How does the writer use structure and language to persuade her readers and support her feelings about immigration? Write an essay using evidence from the letter to answer the question.
Thesis Statement: The author of this letter, (Brittany Taylor) Uses her experience, also a helpful language to talk the reader into agreeing with her beliefs about immigration, she also uses pathos and ethos to convince the reader to help the DACA program.
PART 1 - ORGANIZING YOUR IDEAS.
Directions: Write a topic sentence for each body paragraph. (One body paragraph should focus on the author's use of structure and one body paragraph should focus on the author's use of language.) Use a mixture of paraphrased examples and direct quotations for your evidence. Write your examples and explanations in complete sentences.
Body paragraph 1
Topic sentence:

Example from text to support topic sentence:

Explanation of how the example serves purpose:

Example from text to support topic sentence:

Explanation of how the example serves purpose:

Body paragraph 2
Topic sentence:

Example from text to support topic sentence:

Explanation of how the example serves purpose:

Example from text to support topic sentence:

Explanation of how the example serves purpose:

Part 2 — Developing body paragraphs

Directions: Use your planning in Part 1 to write your two body paragraphs. Use complete sentences, proper grammar and punctuation, and transitions to develop your body paragraphs. Each body paragraph should have a transition at the beginning of the topic sentence and at Least two within each paragraph.

PLEASE HELP!!! (please don’t send one of those ‘click here to learn more about body paragraphs’ please)

Answers

1. The author effectively uses her personal experience to structure her argument in support of immigration and the DACA program.

2. The author employs emotive language and appeals to the readers' emotions to persuade them to support immigration and the DACA program.

How to illustrate the information?

In Body Paragraph 1, the author, Brittany Taylor, begins her letter by sharing her own experiences as a Dreamer, which immediately establishes her credibility and authority on the topic. She writes, "I am a Dreamer, and I have been living in the United States for over 20 years". This personal connection to the issue immediately draws the reader in and creates a sense of empathy and understanding for her perspective. l

In Body Paragraph 2, the author uses emotive language throughout her letter to appeal to the readers' emotions and persuade them to support immigration and the DACA program. For instance, she writes, "I am not a criminal, a burden, or a second-class citizen. I am a human being with a dream" (Taylor). This use of language creates a sense of urgency and highlights the humanity of those affected by immigration policies. Additionally, the author uses phrases such as "heartless" and "cruel" to describe the potential ending of the DACA program, which creates a visceral reaction in the reader and makes it clear that this is an issue of morality and compassion.

Learn more about I Too Have A Dream on

https://brainly.com/question/23940000

#SPJ1

3. Which of the following sentences best expresses the connection between Part I and Part II of
the poem "Alone"?
(1 point)
O The speaker understands what it feels like to experience a deep and overwhelming sense of fear.
O The speaker contemplates how his views have changed as a result of having come so close to dying.
O The speaker expresses relief and gratitude at having been rescued from a horrific car accident.
O The speaker realizes the importance of solitude and his desire to find a peaceful place away from others.

Answers

Answer:

The speaker realizes the importance of solitude and his desire to find a peaceful place away from others.

Explanation:

need help its for a mayor grade

Answers

Don’t pay attention to the link!!!!

PLEASE HELP THIS IS VERY IMPORTANT I WILL GIVE YOU BRAIN THING IF ITS CORRECT AND NO LINKS PLEASE
please somebody do this :(

Answers

I answered your first post! :)

The details at the beginning of a story introduce
conflict and important events.
whether a confict was resolved.
setting and characters.
how a character has changed.

Answers

The story introduces the setting and characters, so C.

Thoreau writes that “I went into the woods because I wish to live deliberately.” He then goes on to describe what living deliberately means to him—a life away from society and the establishment. After reading this excerpt, do you agree or disagree with his philosophy? Using evidence from the text, as well as your own experiences, write a personal essay in which you explain how you “live deliberately.”

Answers

The above question requires a personal answer based on your opinion of what it means to live deliberately. For that reason, I can't write an answer, but I'll show you how to do it.

Answer structureShow what your opinion is about what it means to live deliberately.Show why you feel this way about deliberate living.Show whether your opinion is in line with Thoreau's opinion or if it is against his opinion.

For Thoreau, living deliberately meant moving away from society and urban life. This is because, for him, living deliberately meant moving away from vanity, consumerism, and attachment to material things that the urban environment stimulates in all its inhabitants.

You might agree with that, but you might also think that living in society and strengthening urban centers and the necessary conditions for living within them provide people with the possibility of deliberate living. This idea combats Thoreau's opinion, but it shows an acceptable alternative.

Below you can see an example of how this response can be established.

I believe that living deliberately is only possible within a fair society, where people have all the necessary resources to live well within urban environments. This opinion is established by the thought that only with the supply of all our needs, we will live deliberately and be happy. With that, I do not agree with Thoreau's opinion, because life in nature would not be able to meet the needs of modern human beings, preventing us from living deliberately and being happy there.

Learn more about Thoreau:

https://brainly.com/question/29528789

#SPJ1

Read the excerpt from act 5, scene 1, of Julius Caesar.

CASSIUS. Now, most noble Brutus,
The gods today stand friendly, that we may,
Lovers in peace, lead on our days to age.
But since the affairs of men rest still incertain,
Let’s reason with the worst that may befall.
If we do lose this battle, then is this
The very last time we shall speak together:
What are you then determinèd to do?

What does Cassius’s description of Brutus as noble rather than the synonym aristocratic tell us about his feelings toward Brutus?

Using aristocratic would be a compliment while noble has become a description that includes sarcasm.
Using noble shows how motivated both Brutus and Cassius are by a love of peace.
Using aristocratic would be insulting to Brutus while noble suggests the positive qualities Cassius sees in him such as dignity, generosity, and compassion.
Using noble is a term of endearment and great respect between longtime loyal friends where aristocratic would be impersonal.

Answers

Answer:

Using aristocratic would be a compliment while noble has become a description that includes sarcasm.

Explanation:

The thing which Cassius’s description of Brutus as noble rather than the synonym aristocratic is option A.

What is Sarcasm?

This is a figure of speech that makes use of words and situations which are opposite in meaning or are unintended to what a person is saying or a given situation.

Hence, we can see that based on Cassius' description of Brutus, we can see that by calling him noble, he is using sarcasm to describe him because he does not think he is noble.

Read more about sarcasm here:

https://brainly.com/question/2427130

What are Madison's reasons for supporting a republican form of government?
It would make the nation less vulnerable to foreign interference.
It would provide greater flexibility to change the government if problems arise.
It would give the individual states more power to better serve their own citizens.
It would limit the ability of factions and special interests to infringe on the interests of others.

Answers

Answer:

It would make the nation less vulnerable to foreign interference.

Explanation:

There is a many-colored scarf hanging from a nail. MR. FRANK takes it, putting it around his neck. As he starts back for his rucksack, his eye is caught by something lying on the floor. It is a woman's white glove. He holds it in his hand and suddenly all of his self-control is gone. He breaks down crying.

Answers

Answer:

what is the question?

Explanation:

oh umm wheres the question?

Adopt the perspective of Mathilde Loisel, and write a diary entry in which you explain how your life changed
after the party. Use elements in the story, but also feel free to add new elements from your own
imagination. Pay particular attention to the role that poverty and hardship begin to play in Mathilde's life.
Be sure to mention the contributions Mathilde's husband makes.

Answers

Answer:

I don't know the context of this quesion

Explanation:

Bruce and Sarah’s union has proven ............. useless

Answers

Answer:

Bruce and Sarah’s union has proven itself useless.​

Explanation:

Finding the right word or phrase to fill in the blank in the question offers a language challenge for us. Because it is the reflexive form of "it," the word "itself" is a reflexive pronoun. When used as an object referring to the same thing that is the sentence's subject or that was stated before in the sentence, it is especially helpful. When the word "itself" is used in this sentence, it alludes to the union between Bruce and Sarah. It gives the statement the right meaning and can be utilized to finish the gap in the given incomplete sentence.

The University of San Francisco's Jesuit tradition emphasizes community engagement and education for social justice, inspiring our students to become passionate agents for others. How do you see yourself becoming a part of this mission?
PLEASEEE HELP. I WILL MARK BRANLIEST. PLEASE ORIGINAL

Answers

Answer:

I see myself becoming a part of this mission by engaging with my local community, volunteering my time to help those in need, and educating myself on social justice issues. I also want to use my education to empower others and help create a more equitable society.

Explanation:

Other Questions
Lila swam 50 meters north in 10 seconds. Find Lila's velocity TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets. True/False: Money is more important than finding something you're going to lovedoing. Select the correct answer.Which of these is an example of elemental carbon?A. DiamondB. MethaneC. Proteins 6 less than 3 times a number 42 what is the number Two numbers total 31 and have a difference of 9. Find the two numbers. Can someone help me with this question? Can someone please help me with math. The process by which keys are managed by a third party, such as a trusted CA, is known as?O Key escrowO Key destructionO Key renewalO Key management Which sentence best states the central idea of the account?A After the Civil War, the city of San Antonio prospered.B San Antonio is famous because of the Alamo.C Market Square is a large Mexican marketplace in San Antonio.D San Antonio is a thriving city with a fascinating history. Name the minor arcs in the circle Select all the minor arcs by their correct names. (a+b+c)(a-b+c)=a2+b2+c2 prove A nurse is caring for a patient with SIADH. What severe complication should the nurse assess for?a.Strokeb.Diabetes insipidusc.Neurologic damaged.Renal failure Find the measure of angle A, Find the error with subject-verb agreement. Select the incorrect verb and type it correctly.In Chile's arid Atacama Desert there is areas where any rainfall has yet to berecorded Una onda sonora se produce durante 1,5 s. Posee una longitud de onda de 2,4 m y una velocidad de 340 m/s. a) Cul es la frecuencia de la onda?, Ezra has a hard time sticking with exercise routines. He does well for a few weeks, but then tends to slack off a bit. What would be the BEST way for Ezra to motivate himself to stay on the program that he creates for himself? Read the excerpt from "This World is not Conclusion by Emily Dickinson.This World is not Conclusion.A Species stands beyond -Invisible, as Music -But positive, as Sound -It beckons, and it baffles -Philosophy, dont know -And through a Riddle, at the last -Sagacity*, must go.*the quality of being perceptiveWhich statement best describes how capital letters add to the poems overall meaning?They emphasize ideas that cannot easily be understood.They highlight things the speaker would like to do.They suggest that the speaker often overthinks problems.They explain why the world will continue forever. What is the domain of 1 x? As a universal precaution, use _______ whenever possible if you are going to be in contact with bodily fluids. A. latex gloves B. band-aids C. lotion D. water