Answer:
1. Translation
2. Ribosome
3. Peptide
4. Amino acids
5. Proteins
Explanation:
tRNA, known as transfer RNA, is a special type of RNA that functions majorly in the translation process where. tRNA reads the codons in the mRNA molecule using its anticodons and carries corresponding amino acids to the growing peptide chain in the ribosome. The amino acids are later used to form proteins.
Based on the above explanation, the answers to the blank spaces in the question are typed in BOLD:
- tRNA is used during TRANSLATION in the organelle named RIBOSOME to form long PEPTIDE chains of AMINO ACIDS which are then sent on to be folded and formed into PROTEINS.
Why are there not large, visible colonies of bacteria like those in the petri dish on the things we use every day?
(please don't write anything randomly or else I will report your account for nonsense)
Answer: most likely because there is constant air flow around us most of the time. It also depends on what materials are around us and the moisture level. For example, most bacteria cannot grow on metals, especially copper because of the way it’s composed.
Explanation:
_________ refers to a pea plant that is either homozygous dominant or homozygous recessive for a particular trait.
Answer:
A purebred.
Explanation:
A purebred is an animal or plant that carries two identical alleles for a particular gene or trait. This means that if the pea plant is homozygous dominant (has two of the same dominant alleles), or homozygous recessive (has two of the same recessive alleles), it is considered a purebred. A purebred always expresses only one form of the trait.
Conventional CPR provides 15% of normal blood flow to the heart and blood flow to the brain is 25% of normal. The Res Q Pod is an impedance device that prevents unnecessary air from entering the chest during the compression phase of CPR. When air is prevented from rushing into the lungs as the chest wall recoils, the vacuum (negative pressure) in the thorax pulls more blood back to the heart, resulting in:
The Res Q POD ITD lowers intrathoracic stress at some point of the draw back segment of CPR with the aid of using selectively limiting pointless airflow into the chest.
This vacuum will increase preload, lowers intracranial stress (ICP), and improves blood go with the drift to the mind and crucial organs. Compress the ResQPUMP towards a clean difficult floor with about 50 kg of pressure, the use of the pressure gauge at the ResQPUMP as a guide. Observe for an growing gauge reading. 3. Pull up at the deal with with about 10 to fifteen kg of pressure, the use of the decompression pressure gauge as a guide. The CPR remarks gadgets permit to screen the best of resuscitation and tell the rescuer approximately the fundamental parameters of the guide chest compressions being performed, consisting of chest compression price and depth, and complete chest recoil.
To learn more about CPR check the link below:
https://brainly.com/question/3725035
#SPJ4
While both the endocrine and nervous systems are involved with communication, they differ in their mechanisms. What is one difference between hormones of the endocrine system and neurotransmitters of the nervous system
Answer:
Hormones are released by the glands in the endocrine system and are transmitted into the bloodstream..while neurotransmitters are released by the presynaptic terminal in the synapse and are transmitted across the synaptic cleft....
I hope this helps
Question 3
What level of organization include, coral, fish, eels, and the water in a tropical weather system near the Amazon Rainforest?
A Biome
B Biosphere
C Community
D) Population
The level of the organization includes coral, fish, eels, and the water in a tropical weather system near the Amazon Rainforest is biome. The correct option is A.
What is a biome?While aquatic biomes encompass both oceanic and freshwater biomes, terrestrial biomes are based on land. A place is categorized as a biome based on the species that call it home.
Scientists can identify a biome by defining the temperature range, soil type, and amounts of light and water that are specific to that location and create niches for particular species.
The Conifer Forest is another name for them. The evergreen trees with conical shapes are part of the vegetation. The taiga biome experiences moderate precipitation. Short, rainy summers alternate with long, chilly winters. There is a lot of snowfall in the winter and a lot of rainfall in the summer.
Therefore, the correct option is A, Biome.
To learn more about a biome, refer to the link:
https://brainly.com/question/11491362
#SPJ2
what is binomial nomenclature. please help ASAP
binomial nomenclature definition
Explanation:
the system of nomenclature in which two terms are used to denote a species of living organism, the first one indicating the genus and the second the specific epithet.
Answer:
the system of nomenclature in which two terms are used to denote a species of living organism, the first one indicating the genus and the second the specific epithet.
What food chain is a snail?
Snails are the part of the grazing food chain where they belong to the category of primary consumers.
Food chain is a hierarchical series of energy transfer where one organism feeds upon the lower one to gain energy. There are two main types of food chains: grazing food chain and the detrital food chain. The grazing food chain starts with the autotrophs whereas the grazing food chain begins with the dead and decaying organic matter.
Consumers are the animals that depend on other organisms for their food and energy source. Consumers can be of three types: herbivores, carnivores and omnivores.
To know more about consumers, here
brainly.com/question/2676728
#SPJ4
PLS HELP 20 PTS What other factors might cause individuals in this antelope herd to emigrate
Answer:
When you think about it - this is a similar case that happens in our species as well. You have groups of people who want to emigrate to different countries in hope for better grassland.
They emigrate but are immigrants from the perspective of the grassland where they will be.
The other factors that might cause individuals in this antelope herd to emigrate are immigration, increasing birth rate, and decreasing death rate.
What is emigration?When an animal emigrates, it's because its habitat is no longer ideal for it and it needs to move to a new location with a better habitat. Animals that migrate or emigrate never go back to the place they were originally from.
This is a similar situation to one that occurs in our species. There are various groups of people who want to immigrate to various nations in search of better grasslands. From the perspective of the grassland where they will be, they migrate but are immigrants.
Therefore, Immigration, a rising birth rate, and a declining death rate are some additional factors that could result in members of this antelope herd leaving the group.
To learn more about emigration, refer to the below link:
https://brainly.com/question/902200
#SPJ2
Help me with this question please.
Answer:
C
Explanation:
Hydro means water, water is a renewable source. hope this helps!
HELP PLEASE!!!! growing on
With secondary
Primary succession begins with plants like
succession is already present.
lichens...bare rock...soil
moss...soil...a habitat
dandelions...bare rock...a habitat
palm trees...soil...an animal
Answer: Is A
Explanation:
Lichens break down rock from there the soil start to create life i don't how to explain it
A heterozygous purple flowered plants is crossed with one that is while.
Explanation:
A = Purple
a = white
Aa/AA - purple
aa - white
What is the best example of a Mendelian trait in humans?
The best example of a Mendelian trait in humans is phenylketonuria. This illness is an illustration of a Mendelian trait since it is passed down from parents to children when both parents have heterozygous (Aa) and homozygous (Aa) circumstances.
Mendelian qualities are determined by all of Mendel's postulated Laws of Inheritance and are traits that are transferred from parents to children through dominant and recessive alleles of a gene. The lack of an enzyme that turns the amino acid phenylalanine into tyrosine is the root cause of the autosomal recessive inherited disorder. As a result, the amino acid builds up and is converted into the toxic form of phenyl pyruvic acid, which builds up in the brain of the person and causes r-e-t-a-r-d-a-t-i-o-n.
To know more about Mendelian traits please visit
https://brainly.com/question/29754443
#SPJ4
List all the possible genotypes of the offspring from your Punnett
square in question 4. Next to each genotype write the corresponding
phenotype---short stems or tall stems.
we see that there are three possible genotypes that could result from this crossing: AA, Aa, aa. The genotypes AA and Aa will result in the yellow pea phenotype because A is dominant. Only aa will produce the green pea phenotype.
A Punnett square is a graph that makes it simple to ascertain the anticipated proportion of various genotypes in children of two parents. Figure below illustrates a Punnett square for pea plants. In this instance, flowercolor is heterozygous for both parents (Bb). The top of the graph represents the gametes produced by the male parent, while the sides represent the gametes produced by the female parent. By correctly filling in the Punnett square's cells, we may identify the various possible allele combinations in their progeny (alleles).
To learn more about Punnett square please visit here:
https://brainly.com/question/27984422
#SPJ4
Which of the following is an example of one stage in ecological succession?
A. A tree falls over in a forest.
B. Weeds grow in a garden.
C. Fish swim in a pond.
D. A bird lays eggs in a nest.
As a result of sexual reproduction, an organism can pass a gene mutation to its offspring if the mutation occurs in
An organism can pass a gene mutation to its offspring if the mutation occurs in gamete as a result of sexual reproduction .
A mutation can be transmitted down to an organism's progeny if it happens in a germ-line cell (a cell that will develop into gametes, such as egg or sperm). This implies that the mutation will be present in each and every cell of the growing embryo. A parent's genetic mutation may be carried on to their child through their egg or sperm.
Throughout a human's life, these inherited mutations are prevalent in almost every cell of their body. Cystic fibrosis, haemophilia, and sickle cell disease are examples of hereditary mutations. Large-scale evolution only takes into account mutations that can be passed on to future generations. These are known as germ line mutations and they happen in reproductive cells such as eggs and sperm. Environmental factors contribute to mutations.
For such more questions on Mutation :
brainly.com/question/13923224
#SPJ4
Using a microscope, you observe an amoeba moving toward a food source. This is an example of
A) reproduction.
B) cellular structure.
C) metabolism.
D) growth.
E) responsiveness.
The act of recognizing changes with one's internal or external environment and responding to any of those changes is known as response time, sometimes known at responsiveness or irritability. It consists of sensing a stimulus and responding to it.
What is meant by "responsiveness"?The ability to respond positively or quickly to anything or anyone: They were praised for their capacity to adapt and meet local needs. She doesn't pay much attention to her surroundings.
Why is being responsive so important? It is what?Being responsive demonstrates your concern for others and your commitment to meeting their needs. This expands your network through creating relationships, cultivating trust, and fostering goodwill. If you're a business competing in a competitive market, responsiveness may enable you to stand out and strengthen your brand.
To know about more responsiveness visit:
brainly.com/question/10025293
#SPJ4
Which blood type can be donated to the largest percentage of individuals?
Answer:
Type O+
Explanation:
Match the following. 1 . slime mold An organism that only has one cell for its body 2 . organismal theory The basic unit of life according to the cell theory 3 . life cycle The internal spherical structure in a cell which serves as the central control 4 . cell theory Serves to give strength and rigidity to the plant cell 5 . nucleus The living substance of a cell, excluding the nucleus 6 . cytoplasm The outer layer of cells of the stems, roots, and leaves of plants 7 . cell The stages of a plant or animal's life 8 . acellular organism Fluid filled sacs within the cytoplasm of a cell which are bound by a membrane 9 . epidermis The semipermeable membrane surrounding the cell 10 . unicellular organism An organism not divided into cells 11 . matter That which occupies space and has mass 12 . cell wall They are thought to make r-RNA to construct the ribosomes 13 . plasma membrane A functional plant or animal 14 . organism The basic unit of life is the organism itself 15 . vacuole A type of protist which has a stage in its life cycle when it is not divided into cells 16 . nucleolus The basic unit of life is the cell
Answer:
There should be a image
Which of the following statements best explains differences between the finches?
A. Some finches were born with beaks that allowed them to have better access to different sources of food. These finches reproduced and passed on their genes.
B. The beaks of the finches changed so all of the finches could eat the same types of food.
C. The beaks of the finches changed as the species of finches migrated to the same island.
D. The beaks of the finches changed as the finches' body sizes changed.
Answer:
i think it's D I hope this helps :)
Answer:
D is the answer
Explanation:
Please place answers under questions so I know which is which. Thank you! :)
What products are made in light-dependent reactions (photosynthesis)?
What products are made in light-independent reactions (photosynthesis)?
Products: ADP, ATP, NADPH, NADP+, Oxygen, Sugars
The products of the light-dependent reactions are= ATP, NADPH, and O2, and the products of light-independent reactions are= Sugars, ADP, and NADP+.
Photosynthesis has two parts: one is light-dependent and another one is a light-independent reaction (also known as-Calvin cycle). The process is vice versa, where few inputs of the light-dependent reaction are used to make the outputs for the light-independent reaction, and few inputs of the light-independent reaction are used to make the outputs for the light-dependent reaction.
The goal of a light-dependent reaction is to convert light energy into chemical energy. And the location of light-independent reaction is at Chloroplasts—stroma.
To know more about the products of such reactions, refer to:
https://brainly.com/question/1447677
How can katey and amanda's amino acid sequence be the same and yet they may have a differences in their DNA?
Answer: Two people can have different DNA sequences but these sequences can code for the same amino acids due to the redundancy of the genetic code in which two different codons can code for the same amino acid.
Explanation:
The genome of an organism is found in a molecule called DNA (deoxyribonucleic acid). The main function of this DNA molecule is the long-term storage of information to build other components of cells, such as proteins and RNA molecules (ribonucleic acid); and the portion of the genome that codes for a protein or RNA is known as a gene. These protein-coding genes are composed of trinucleotide units called codons, each of which codes for an amino acid. For a protein whose sequence is encoded in the nucleotides of DNA to be synthesized, that DNA molecule must first be transcribed into a molecule called messenger RNA, and this molecule is used for a process called translation or protein synthesis. The sequence of the genetic material is composed of four distinct nitrogenous bases, which are represented by letters in the genetic code:
Adenine (A)Thymine (T)Guanine (G) Cytosine (C)Uracil (U) instead of T in RNAThe genetic code is the set of rules that defines how a sequence of nucleotides in RNA is translated into a sequence of amino acids in a protein. This code is common to all living things, which shows that it has had a unique origin and is universal. So, the code defines the relationship between each sequence of three nucleotides (codon) and each amino acid. The number of possible codons is 64, of which 61 code for amino acids (one of them being the start codon, AUG) and the remaining three are stop sites (UAA, UAG, UGA). The codon sequence determines the amino acid sequence in a particular protein, which will have a specific structure and function.
However, the genetic code has redundancy but no ambiguity. For example, two different codon can code for the same amino acid, and the differences between codons encoding the same amino acid have differences in the third position. This is explained by the wobble effect, where the same anticodon (present in the transfer RNA that loads with the amino acid and interacts with the codon in the messenger RNA) can establish interaction with different codons, which differ in their third base. This is why, in general, tolerance to change at this position is greater than at the first and second positions, and therefore tends to be less represented in the case of variations that result in pathologies.
Thus, two people can have different DNA sequences but these sequences can code for the same amino acids due to the redundancy of the genetic code in which two different codons can code for the same amino acid.
In community ecology we discussed the four main types of Interspecific Interactions. Select the correct answer(s): Group of answer choices Two possible outcomes of competition are resource partitioning and extinction Some bacteria use specialized metabolites (e.g., antibiotics, siderophores) to compete more effectively. Predation has a small impact on microbial community composition in oceans The production/release of antagonistic factors (e.g., lytic compound) to impede competitors is an example of exploitation competition
Answer:
Two possible outcomes of competition are resource partitioning and extinction.
Explanation:
Community ecology is the association of two or more population of different species that occupy the same geographical area within the same time and thus the term studies the interaction that takes place between the species in temporal and spatial scale.5 point
Gregor Mendel discovered the principals of heredity and that genes could
be:
-Strong or weak
-Dominant or recessive
-made dormant or active
Answer:
-Dominant or recessive
Explanation:
Genes can either be dominant or recessive
dominant genes will dominate recessive genes if the phenotype is heterozygous, i.e. the genes have 1 dominant and 1 recessive
8. In a deletion mutation a base my be
C. Moved
A. Left out
B. added in
Answer:
LEFT OUT
hope it help
5. Kimberly draws the food web shown. A reduction in the population of which organism
would reduce the food sources available to all of the other organisms? (1 point)
Answer: Krill
Explanation:
Tha basis for energy of the animals is krill - so reduction in its population would influence all organisms.
Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA
ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA edits the DNA of the first codon to AAA, so it changes to AAA CCG GGC GGC GAG AGC TTG CTA ATT GGC TTA TAA, so its complementary sequence is TTT GGC CCG CCG CTC TCG AAC.
What is DNA?Every cell's DNA contains information that is transformed into brief, portable RNA messages during transcription.
The fact that DNA is in charge of the process known as the protein synthesis method by which cells produce proteins is another highly significant function of DNA.
Therefore, DNA dictates the structure and function of your proteins, every component of your body, including your fingernails, eyes, and many other things are comprised of proteins.
Learn more about DNA, here:
https://brainly.com/question/21992450
#SPJ1
How can a cup of water decrease in temperature? please answer my question in a scientific method, the questions will be below.
Step 1: Observation
Step 2: Research:
Step 3: Hypothesis:
Step 4: Experiment – explain the experiment that you would perform
Step 4a- The control variable
Step 4b- The dependent variable
Step 4c- The independent variable
Step 5- What do you predict the conclusion to be?
The first step for this experiment is observation where it is found that a cup of water decreases in temperature. The rest of the steps are described in the explanation part.
What is a Scientific method?A scientific method may be characterized as the process of objectively establishing facts through testing and experimentation. The basic process involves making an observation, forming a hypothesis, making a prediction, conducting an experiment, and finally analyzing the results.
The second step is research in which a cup of water is placed at different temperatures where it can easily change its state from liquid to solid. The hypothesis governs that the amount of water in a cup may lower or decreases when it is exposed to several temperatures.
The experiment is performed on the basis of certain evidence and assumptions in order to predict some conclusion. The control variable is the influence of temperature. The dependent variable is the amount of water and the independent variable is the exposure to temperature.
Therefore, it is concluded that a cup of water decreases in temperature.
To learn more about the Scientific method, refer to the link:
https://brainly.com/question/497944
#SPJ1
What causes populations to lose genetic diversity due to chance?
Stochastic sampling error (i.e., genetic drift) causes populations to lose genetic diversity due to chance.
Genetic drift is a result of sampling error because individuals are randomly chosen when a population is sampled. A random selection is one in which each member of the population has an equal chance of being chosen.
The random change in allele frequencies caused by stochastic sampling of alleles from the previous generation is known as genetic drift (independent of demographic stochasticity).
The variety of various inherited features within a species is referred to as genetic diversity. There would be many people with a wide range of diverse traits in a species with significant genetic diversity. For a population to adapt to changing surroundings, genetic variety is essential.
To learn more about Genetic diversity :
https://brainly.com/question/14926046
#SPJ4
How can people exercise good and wise Dominion over the process of photosynthesis for God's glory
Wise dominion over the process of photosynthesis can be exercised in such a way that all the people and animals can benefit from it and we can use it correctly.
Photosynthesis is a process that plants and other organisms use to convert light energy into chemical energy that can then be released to fuel the organism's activities via cellular respiration. Some of this chemical energy is stored in carbohydrate molecules, such as sugars and starches, which are formed by the reaction of carbon dioxide and water.
Photosynthesis is performed by the majority of plants, algae, and cyanobacteria; these organisms are known as photoautotrophs. Photosynthesis is responsible for producing and maintaining the oxygen content of the Earth's atmosphere, as well as supplying the majority of the energy required for life on Earth.
To know more about photosynthesis click here,
https://brainly.com/question/29764662
#SPJ4
What happens to the light when you look at a green object?
When you look at a green object, the object reflects green light and absorbs other colors of the visible spectrum. The green light is then transmitted to your eye, where it is focused by the lens onto the retina.
The retina contains specialized cells called rods and cones that are sensitive to different wavelengths of light. The cones in the retina are responsible for color vision and are most sensitive to different colors in the visible spectrum, and when the green light reaches the cones, it triggers a neural signal that is sent to the brain, where it is interpreted as the color green. The absorbed light colors are not reflected and are green absorbed by the object, they are not transmitted to green the eye, so they are not perceived by the observer.
Learn more about light here:
https://brainly.com/question/8181719
#SPJ4