There are 3 identical plants in 3 identical pots. They are all kept at the same temperature and receive the same amount of sunlight each day. One plant is given a full cup of water everyday, another plant is given half a cup of water every day, and the last plant is given no water. After 3 weeks all of the plants were measured and the results were recorded.

Answers

Answer 1

Answer:

If the question is what grew more, than its the plant given a full cup of water everyday.

Explanation:

If it's not the question then I can always come back and edit my answer :D


Related Questions

Which of the following is caused by bad genes? *

Carcinoma
herpes
athlete's foot
vitaligo
bubonic plague

Answers

The answer is Vitaligo because all of the other answers are ones that you develop and not something you’re born with

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC


Highlighted letters are: ATACTACC

Answers

Answer:

1 and 5

Explanation:

https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question

Answer:

1.ATTAGC(ATACTAC)GGGC

5. ATGAATGC(ATACTACC)GGGC

Question 6 of 20
A girl swings a yo-yo around in circles. How can she increase the total energy
of this system?
O
A. Reverse the direction of the swing,
O
B. Stand on a table while swinging the yo-yo.
C. Sit on the ground while swinging the yo-yo.
о
D. Swing the yo-yo at a lower speed,
SUBMIT

Answers

Answer:

it's B

Explanation:

A girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

What is Yo-yo?

Yo-yo may be defined as a type of toy that consists of a pair of joined discs with a deep furrow between them in which thread is attached and wound.

By reversing the direction of the swing, swinging the yo-yo at a lower speed, and sitting on the ground while swinging the yo-yo decrease the total energy of the system. This is because the system does not have the momentum that is required to increase its overall energy.

Therefore, a girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

To learn more about Total energy of the system, refer to the link:

https://brainly.com/question/478253

#SPJ5

Consider the plant cells in the image below. What is a function of the cell structure that is labeled x?

Answers

Answer:

c) It provides support to the plant

Answer:c

Explanation:

Example of reproduction

Answers

Answer:

a deer giving birth to a baby deer

What’s the answer ????????

Answers

it’s d
i looked it up and it’s the exact same:)

Answer:

D: Electrons are transferred from one atom to another.

Explanation:

Protons are not involved in the covalency, and C, electrons are shared between two atoms, is the definition of a covalent bond, such as water. Ionic bonds form when two atoms, share (transfer) electrons to one another in order to fill the outer electron ring.

Hope this helps!

What field of forensics do medical coroners work in?
O Forensic sociology
O Forensic pathology
O Forensic entomology
O Forensic psychiatry

Answers

the answer should forensic pathology :) my apologies if wrong but that should be it

Answer:

THE ANSWER is B

Explanation:

i need to poop

Dependence and Addiction are the
same thing?
a. True
b. False​

Answers

Answer:

b

Explanation:

one is a necessity, the other is a struggle

What is a carbon producer

Answers

Answer:

There are many many things in the world that produces Carbon. The largest source of greenhouse gas emissions from human activities in the United States is from burning fossil fuels for electricity, heat, and transportation. All of these produce Carbon into the atmosphere and warm the planet

PLEASE HELP ME I DONT KNOW THE ANSWER!!!!!

Answers

Answer: I think the answer is ( d) because the two tails are together to get stuck in the membrane as the picture shows

Explanation:

A cell membrane has permeability, which means that the membrane:

Answers

Answer:

transport proteins are specific and selective for the molecules they move, and they often use energy to catalyze passage.

Explanation:

I barley know what your trying to say

please help me, 50 points

What type of bond are the arrows pointing to below in the picture


Answers

Thats is euther hydrogen bond or oxyegn bond. Im leaning towards hydrogen bond

Please put the following in order from Least Inclusive to MOST inclusive...

Organs Molecules Organ Systems
Organism Cells Tissue

A) Organism -> Organ Systems -> Organs -> Tissue -> Cells -> Molecules
B)Atoms -> Cells -> Molecules -> Organs-> Organ Systems -> Organism
C) Molecules -> Cells -> Tissue -> Organs -> Organ Systems -> Organism
D) Cells -> Organism-> Tissue -> Organ Systems -> Molecules -> Organs

Answers

Definitely C. A has it reversed, B includes atoms and puts molecules after cells, and D puts organisms right after cells

The field of Astronomy is not related to technology
O True
False

Answers

Answer:

false

i hope this helps and goodluck!

which statement best describes the forces in the picture?
a. The applied force in the force of friction are balanced.
b. all four forces are the same size.
c. all four forces are acting in the same direction.
d. The applied force in the force of friction are unbalanced.​

Answers

Answer: Its A.

Explanation:

None

The applied force and the force of friction are balanced in the picture because of which the person is standing still. Therefore option (A) is correct.

What is force?

A change in the force that is applied to an item with mass will cause that thing to move at a different speed. A body's state of rest or motion can be altered by the application of an external agent known as force. It is significant in both magnitude and direction.

The term "frictional force" refers to the force that is produced when two surfaces come into contact with one another and then slide against one another. A few factors that affect the force of friction are as follows: These forces are primarily influenced by the surface texture as well as the amount of force that is drawing them closer together.

Learn more about force, here:

https://brainly.com/question/13014979

#SPJ5

what are thylakoids? I will give BRAINLIEST!!

Answers

Answer:

each of a number of flattened sacs inside a chloroplast, bounded by pigmented membranes on which the light reactions of photosynthesis take place, and arranged in stacks or grana.

Thylakoids are membrane-bound compartments inside chloroplasts and cyanobacteria. They are the site of the light-dependent reactions of photosynthesis. Thylakoids consist of a thylakoid membrane surrounding a thylakoid lumen. Chloroplast thylakoids frequently form stacks of disks referred to as grana.

Explanation:

Answer:

They are membrane-bound compartments inside chloroplasts (the food producers of the cell) and cyanobacteria (group of photosynthetic bacteria).

What are the differences between the Big Bang Theory and the Steady State Theory?

Answers

Answer

One is a move and the other is a part of a state.

Explanation:

Answer:

The only difference, he explained, was that in the big bang scenario all the matter was created in one explosive beginning.

Write a one-paragraph essay that summarizes the relationship between chloroplasts and
chlorophyll, making sure to include how they work together in photosynthesis.

Answers

Answer:

New algorithms for estimating chlorophyll-a in the Spanish waters of the Western Mediterranean Sea from multiplatform imagery This manuscript proposes a set of multi-sensor chlorophyll-a empirical algorithms for improving current estimates of chlorophyll-a concentration in two distinct regions in the Mediterranean Sea.

Many studies in the area of cancer research are opening up new possibilities for cures and prevention measures.  One area of research is directed at the effects that chlorophyll may have on cancer cells within the human body.  Research is being conducted to investigate whether chlorophyll has important cancer fighting factors that may play a role in the destruction of cancer cells or whether it is an effective preventive agent.  

Daily supplements of the chlorophyll derivative, chlorophyllin (CHL) can provide a way to prevent cancer by reducing DNA damage  (Arbogast, 1995).   The chlorophyllin copper complex (CHL) is a water-soluble version of chlorophyll and is a semi-synthetic prepared substance.  CHL is the most common chlorophyll derivative used for cancer related studies  (Chernomorsky, 1999).  Most research was done using chlorophyllin because chlorophyll is chemically modified to chlorophyllin in the body during digestion. Chlorophyllin given in amounts to that of chlorophyll were equally effective in the studies  (Sarkar, 1994).  CHL can be added to the diet very easily and may be safe and useful for effective prevention of cancer  (Arbogast, 1995).

Explanation:

Hope this is what you wanted.

Which of the following is an example of a complex machine?
1. Pulley
2. Wedge
3. Scissors
4. Incline

Answers

3- Scissors are an example of a complex machine.

Answer:

A :3

Explanation:

Just did acceleratted ed. Hope this helps!

Choose one carbon sink and explain how the carbon gets out of it.

Answers

Answer::

Explanation:

At what temperatures can monarch fly?

Answers

Answer:55 degrees

Explanation:In order for an adult monarch to fly, temperatures need to be above 55 degrees Fahrenheit.

Answer:

Temperatures need to be above 55 degrees Fahrenheit.

Explanation:

Explain the law's of segregation and independent assortment.

Answers

Answer:

The law of segregation states that the two alleles of a single trait will separate randomly, meaning that there is a 50% either allele will end up in either gamete. This has to do with 1 gene. The law of independent assortment states that the allele of one gene separates independently of an allele of another gene.

Explanation:

I know it late but can u plz mark me brainliest?

science is so confusing to me!

Select all answers that are correct.

If people have never observed matter (mass) to be created or destroyed, then using inductive reasoning, it would be logical to conclude that:


the known laws of science cannot account for the origin of mass
the amount (quantity) of mass in the universe has never changed
the mass of the universe must have created itself

Answers

Answer:

second one.

Explanation:

not sure but it's the only answer that goes with the other laws

What does “denature” mean in terms of protein structure?

Answers

Explanation:

Denaturation, in biology, process modifying the molecular structure of a protein. Denaturation involves the breaking of many of the weak linkages, or bonds (e.g., hydrogen bonds), within a protein molecule that are responsible for the highly ordered structure of the protein in its natural (native) state.


What problems can pseudoscience cause for society?

Answers

Answer:

It is quite difficult to picture a pseudoscientist—really picture him or her over the course of a day, a year, or a whole career. What kind or research does he or she actually do, what differentiates him or her from a carpenter, or a historian, or a working scientist? In short, what do such people think they are up to?

… it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

The answer might surprise you. When they find time after the obligation of supporting themselves, they read papers in specific areas, propose theories, gather data, write articles, and, maybe, publish them. What they imagine they are doing is, in a word, “science”. They might be wrong about that—many of us hold incorrect judgments about the true nature of our activities—but surely it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

NEED ASAP


Which quality would make the question "What will make cows produce more milk?" a good scientific question for a
biologist to investigate?
A) It is about living things and is testable.
B) It will help consumers save money.
C) It will lead to new technology to gather milk.
D) It is a question that can have many answers.

Answers

Answer:

D

Explanation:

The scientist could find new tech, which could lead to lower prices, also, it is about living things and testable, so it would be many answers.

Which accurately labels the cytoplasm?
w
Х
Y
Z

Answers

Answer:

Y is the answer

Explanation:

I am 100%sure that the answer is Y

Which of the following correctly identifies the function of the cell membrane?
A
controls what enters and leaves the cell
B
produces protein and enzymes
C С
controls the cell function
D
stores genetic infromation for the cell

Answers

Answer:

a controls what enters and leaves the cell

Explanation:

which of the following statements are true?
A. Flavr Savr tomatoes are still commercially successful.
B. A large percentage of US crops are currently genetically engineered.
C. Glyphosate kills all plant life, even genetically altered plants.
D. None of these are true

Answers

B! we had to alter them to our preferred taste and nutrients

Which of the following is a term use to describe a mound, hill of ridge of wind-blown sand?
A.peak
B.hill
C.contour
D.dune​

Answers

The answer is D.dune
Other Questions
Which of the following is not a Spanish idiom Which sphere contains the solid part of the Earth that is covered with non-living rock, soil, minerals, and landforms?A. BiosphereB. GeosphereC. HydrosphereD. Cryosphere reasons why a computer system is said to be more intelligent than human brain What song gets stuck in your head? How does it make you feel the first time you hear that song? The hundredth time you hear it grandpa has some cows and ducks in his farm. all in all there are 8 heads and 26 legs, how many cows and ducks are in there? solve this using factoring, finding multiples and divisibility rules The rectangle shown is enlarged such that each side is multiplied by the value of the width, 2x. Which expression represents the perimeter of the enlarged rectangle? The rectangle shown is enlarged such that each side is multiplied by the value of the width, 2x. Which expression represents the perimeter of the enlarged rectangle? A. 4x + 2y B. 8x^2 + 2y C. 4x^2+2xy D. 8x^2+4xy Please I need some answers I need help ( just give me any answer that is true)What happened to Puerto Rico after gaining independence from Spain? 12. Which of the following is NOT a liability?O bank loansO overhead costsO capitalO employee salaries Jake goes to the vampire School every 4 days and Werewolf School every 6 days. If he goes to both on October 3rd, on what date will he go to both again? does anyone else hate school right know What is the image of (3, 6) when it is translated along the horizontal vector -2,0? ANSWER QUICK PLS!!In order to be considered a civilization, a society must: A. Be controlled by religious leadersB. Grow crops without using irrigationC. Communicate without a written languageD. Build cities with large populationsPLS HURRY!!! Classes are canceled due to snow, so you take advantage of the extra time to conduct some physics experiments. You fasten a large toy rocket to the back of a sled, and take the modified sled to a large, flat, snowy field. You ignite the rocket, and observe that the sled accelerates from rest in the forward direction at a rate of 13.5 m/s2 for a time period of 3.30 s. After this time period, the rocket engine abruptly shuts off, and the sled subsequently undergoes a constant backward acceleration due to friction of 6.15 m/s2.After the rocket turns off, how much time does it take for the sled to come to a stop?By the time the sled finally comes to a rest, how far has it traveled from its starting point? Please help me answer this :) tell whether each triangle with the given side lengths is a right triangle which two is it if u get it correct u get brainlist Which inequality best represents the domain of the part shown Which explains the difference between the equator and the prime meridian?The equator separates the Northern and Southern hemispheres, while the prime meridian divides the Western and Eastern hemispheres.The equator separates the Western and Eastern hemispheres, while the prime meridian divides the Northern and Southern hemispheres.The equator separates the Northern and Western hemispheres, while the prime meridian divides the Southern and Eastern hemispheres.The equator separates the Western and Southern hemispheres, while the prime meridian divides the Northern and Eastern hemispheres. Te ________ para la clase de baile? Con quin ________?A. inscribimos, hablamosB. inscrib, hablC. inscribiste, hablasteD. inscribi, hablI