The oxygen pulls harder on the shared electrons than hydrogen. The result of this is that the hydrogen have a __________?

None of the above
Partial negative charge
Partial positive charge

Answers

Answer 1

Answer:

b

Explanation:

Partial negative charge


Related Questions

Which factor is different between the tundra biome and a tundra ecosystem?
A. Soil moisture
B. Climate
C. Size
D. Type of plants

Answers

Answer:

b it is the climate

Explanation:

B the climate

Answer  C.Size

Explanation:

the reason why it is not climate is because the climate is the same. So as the soil moisture. The tundra biome is a bigger size than the ecosystem. The order from largest to smallest level of organism: biosphere,biome,ecosystem,community, population, and last organism.

Write a one-paragraph essay that summarizes the relationship between chloroplasts and
chlorophyll, making sure to include how they work together in photosynthesis.

Answers

Answer:

New algorithms for estimating chlorophyll-a in the Spanish waters of the Western Mediterranean Sea from multiplatform imagery This manuscript proposes a set of multi-sensor chlorophyll-a empirical algorithms for improving current estimates of chlorophyll-a concentration in two distinct regions in the Mediterranean Sea.

Many studies in the area of cancer research are opening up new possibilities for cures and prevention measures.  One area of research is directed at the effects that chlorophyll may have on cancer cells within the human body.  Research is being conducted to investigate whether chlorophyll has important cancer fighting factors that may play a role in the destruction of cancer cells or whether it is an effective preventive agent.  

Daily supplements of the chlorophyll derivative, chlorophyllin (CHL) can provide a way to prevent cancer by reducing DNA damage  (Arbogast, 1995).   The chlorophyllin copper complex (CHL) is a water-soluble version of chlorophyll and is a semi-synthetic prepared substance.  CHL is the most common chlorophyll derivative used for cancer related studies  (Chernomorsky, 1999).  Most research was done using chlorophyllin because chlorophyll is chemically modified to chlorophyllin in the body during digestion. Chlorophyllin given in amounts to that of chlorophyll were equally effective in the studies  (Sarkar, 1994).  CHL can be added to the diet very easily and may be safe and useful for effective prevention of cancer  (Arbogast, 1995).

Explanation:

Hope this is what you wanted.

Which of the following is a term use to describe a mound, hill of ridge of wind-blown sand?
A.peak
B.hill
C.contour
D.dune​

Answers

The answer is D.dune

Which accurately labels the cytoplasm?
w
Х
Y
Z

Answers

Answer:

Y is the answer

Explanation:

I am 100%sure that the answer is Y

What’s the answer ????????

Answers

it’s d
i looked it up and it’s the exact same:)

Answer:

D: Electrons are transferred from one atom to another.

Explanation:

Protons are not involved in the covalency, and C, electrons are shared between two atoms, is the definition of a covalent bond, such as water. Ionic bonds form when two atoms, share (transfer) electrons to one another in order to fill the outer electron ring.

Hope this helps!

Explain the law's of segregation and independent assortment.

Answers

Answer:

The law of segregation states that the two alleles of a single trait will separate randomly, meaning that there is a 50% either allele will end up in either gamete. This has to do with 1 gene. The law of independent assortment states that the allele of one gene separates independently of an allele of another gene.

Explanation:

I know it late but can u plz mark me brainliest?

What are the differences between the Big Bang Theory and the Steady State Theory?

Answers

Answer

One is a move and the other is a part of a state.

Explanation:

Answer:

The only difference, he explained, was that in the big bang scenario all the matter was created in one explosive beginning.

science is so confusing to me!

Select all answers that are correct.

If people have never observed matter (mass) to be created or destroyed, then using inductive reasoning, it would be logical to conclude that:


the known laws of science cannot account for the origin of mass
the amount (quantity) of mass in the universe has never changed
the mass of the universe must have created itself

Answers

Answer:

second one.

Explanation:

not sure but it's the only answer that goes with the other laws

what is human intercose

practical of human intercose​

Answers

Answer:

Sexual intercourse, also called coitus or copulation, reproductive act in which the male reproductive organ (in humans and other higher animals)

Which of the following is an example of a complex machine?
1. Pulley
2. Wedge
3. Scissors
4. Incline

Answers

3- Scissors are an example of a complex machine.

Answer:

A :3

Explanation:

Just did acceleratted ed. Hope this helps!

which statement best describes the forces in the picture?
a. The applied force in the force of friction are balanced.
b. all four forces are the same size.
c. all four forces are acting in the same direction.
d. The applied force in the force of friction are unbalanced.​

Answers

Answer: Its A.

Explanation:

None

The applied force and the force of friction are balanced in the picture because of which the person is standing still. Therefore option (A) is correct.

What is force?

A change in the force that is applied to an item with mass will cause that thing to move at a different speed. A body's state of rest or motion can be altered by the application of an external agent known as force. It is significant in both magnitude and direction.

The term "frictional force" refers to the force that is produced when two surfaces come into contact with one another and then slide against one another. A few factors that affect the force of friction are as follows: These forces are primarily influenced by the surface texture as well as the amount of force that is drawing them closer together.

Learn more about force, here:

https://brainly.com/question/13014979

#SPJ5

which of the following statements are true?
A. Flavr Savr tomatoes are still commercially successful.
B. A large percentage of US crops are currently genetically engineered.
C. Glyphosate kills all plant life, even genetically altered plants.
D. None of these are true

Answers

B! we had to alter them to our preferred taste and nutrients

Please put the following in order from Least Inclusive to MOST inclusive...

Organs Molecules Organ Systems
Organism Cells Tissue

A) Organism -> Organ Systems -> Organs -> Tissue -> Cells -> Molecules
B)Atoms -> Cells -> Molecules -> Organs-> Organ Systems -> Organism
C) Molecules -> Cells -> Tissue -> Organs -> Organ Systems -> Organism
D) Cells -> Organism-> Tissue -> Organ Systems -> Molecules -> Organs

Answers

Definitely C. A has it reversed, B includes atoms and puts molecules after cells, and D puts organisms right after cells

PLEASE HELP ME I DONT KNOW THE ANSWER!!!!!

Answers

Answer: I think the answer is ( d) because the two tails are together to get stuck in the membrane as the picture shows

Explanation:

What field of forensics do medical coroners work in?
O Forensic sociology
O Forensic pathology
O Forensic entomology
O Forensic psychiatry

Answers

the answer should forensic pathology :) my apologies if wrong but that should be it

Answer:

THE ANSWER is B

Explanation:

i need to poop

A cell membrane has permeability, which means that the membrane:

Answers

Answer:

transport proteins are specific and selective for the molecules they move, and they often use energy to catalyze passage.

Explanation:

I barley know what your trying to say

What does “denature” mean in terms of protein structure?

Answers

Explanation:

Denaturation, in biology, process modifying the molecular structure of a protein. Denaturation involves the breaking of many of the weak linkages, or bonds (e.g., hydrogen bonds), within a protein molecule that are responsible for the highly ordered structure of the protein in its natural (native) state.

Choose one carbon sink and explain how the carbon gets out of it.

Answers

Answer::

Explanation:

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC


Highlighted letters are: ATACTACC

Answers

Answer:

1 and 5

Explanation:

https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question

Answer:

1.ATTAGC(ATACTAC)GGGC

5. ATGAATGC(ATACTACC)GGGC

What is the use of tail in human sperm?​

Answers

It’s an adaptation that allows the sperm to travel to the egg more efficiently as the distance is long and most sperm do not make it to the egg so this increases the chance of fertilisation.

Explanation:

NEED ASAP


Which quality would make the question "What will make cows produce more milk?" a good scientific question for a
biologist to investigate?
A) It is about living things and is testable.
B) It will help consumers save money.
C) It will lead to new technology to gather milk.
D) It is a question that can have many answers.

Answers

Answer:

D

Explanation:

The scientist could find new tech, which could lead to lower prices, also, it is about living things and testable, so it would be many answers.

please help me, 50 points

What type of bond are the arrows pointing to below in the picture


Answers

Thats is euther hydrogen bond or oxyegn bond. Im leaning towards hydrogen bond

Example of reproduction

Answers

Answer:

a deer giving birth to a baby deer

2. Describe a situation in which unbalanced forces are acting on an object. What is the net force
on the object, and how does the net force change the motion of the object?

Answers

Answer:

The force is by putting the two same objects on both sides and the motion is the scale

The force is by putting the two same objects on both sides and the motion is the scale.

What do you mean by force?

In physics, a force is an influence that can change the motion of an object. A force can cause an object with mass to change its velocity, i.e., to accelerate. Force can also be described intuitively as a push or a pull.

The normal force acts in a direction normal to the surface interaction between objects. Friction is a force that opposes motion on surfaces. Other examples of non-fundamental forces include the elastic force, tension.

Force is the fundamental result of an interaction between two objects, while power is an expression of energy consumed over time (work), of which force is an element.

Learn more about force:

https://brainly.com/question/13191643

#SPJ2

At what temperatures can monarch fly?

Answers

Answer:55 degrees

Explanation:In order for an adult monarch to fly, temperatures need to be above 55 degrees Fahrenheit.

Answer:

Temperatures need to be above 55 degrees Fahrenheit.

Explanation:

What is a carbon producer

Answers

Answer:

There are many many things in the world that produces Carbon. The largest source of greenhouse gas emissions from human activities in the United States is from burning fossil fuels for electricity, heat, and transportation. All of these produce Carbon into the atmosphere and warm the planet


What problems can pseudoscience cause for society?

Answers

Answer:

It is quite difficult to picture a pseudoscientist—really picture him or her over the course of a day, a year, or a whole career. What kind or research does he or she actually do, what differentiates him or her from a carpenter, or a historian, or a working scientist? In short, what do such people think they are up to?

… it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

The answer might surprise you. When they find time after the obligation of supporting themselves, they read papers in specific areas, propose theories, gather data, write articles, and, maybe, publish them. What they imagine they are doing is, in a word, “science”. They might be wrong about that—many of us hold incorrect judgments about the true nature of our activities—but surely it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

Question 6 of 20
A girl swings a yo-yo around in circles. How can she increase the total energy
of this system?
O
A. Reverse the direction of the swing,
O
B. Stand on a table while swinging the yo-yo.
C. Sit on the ground while swinging the yo-yo.
о
D. Swing the yo-yo at a lower speed,
SUBMIT

Answers

Answer:

it's B

Explanation:

A girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

What is Yo-yo?

Yo-yo may be defined as a type of toy that consists of a pair of joined discs with a deep furrow between them in which thread is attached and wound.

By reversing the direction of the swing, swinging the yo-yo at a lower speed, and sitting on the ground while swinging the yo-yo decrease the total energy of the system. This is because the system does not have the momentum that is required to increase its overall energy.

Therefore, a girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

To learn more about Total energy of the system, refer to the link:

https://brainly.com/question/478253

#SPJ5

Which of the following is caused by bad genes? *

Carcinoma
herpes
athlete's foot
vitaligo
bubonic plague

Answers

The answer is Vitaligo because all of the other answers are ones that you develop and not something you’re born with

Which of the following correctly identifies the function of the cell membrane?
A
controls what enters and leaves the cell
B
produces protein and enzymes
C С
controls the cell function
D
stores genetic infromation for the cell

Answers

Answer:

a controls what enters and leaves the cell

Explanation:

Other Questions
x/10 +6 8 (please help me with this asap) Predictions is to educated guesses as _____ is to quotations directly from a source. a) proof b) textual evidence Please see if you can do this problem! Thank you so so much!! What is the equation of the line that passes through point ( -6, 5) with a slope of 4?I chose y=4x+29 but got it wrong Elena wants to make a scale drawing of her bedroom. Her bedroom is a rectangle with length 5 m and width 3 m. She decides on a scale of 1 to 50. Elena's bedroom door is 0.08 m. How wide should the door be on the scale drawing? Elena's bed measures 4 cm by 3 cm on the scale drawing. What are the actual measurements of her bed What is the value of xA) [tex]56^\circ[/tex]B) [tex]132^\circ[/tex]C) [tex]72^\circ[/tex]D) [tex]124^\circ[/tex] -3 3/7 x 3/8. Explain step by step. Anyone sure of what the answer is Solve 6kx = 4kx + 8 for x.Start by collecting the variable terms on the same side of the equation.What is the first step? How did Downtown Abbey, portray the era they were in? WILL NAME BRAINLIST! What is one effect that an in medias res opening is meant to have on the reader? A. the reader is meant to predict how the story will end B. the reader is meant to get hooked on the story from the beginning C. the reader is meant to identify with characters quickly D. the reader is suppose to pick up on the theme of the story When the wedges are removed, predict which way the carts will move. Justify your prediction. What inference about the Haida peoples life experiences can be drawn from the details in this story? Find the slope: A.3/5B.5/3C-3/5D.-5/3 Elyse wants to buy a new softball glove that costs $45. She has $15 and plans to save 5 each week. How many weeks will it take her to save the money? DNA _____.exists in all cellsis found in the nucleus of prokaryotesis found in the cytoplasm of eukaryotesis made of tightly coiled chromosomes if a = 4 and b=3, what is the value of (a+b) (a-b) A company estimates that 0.7% of their products will fail after the original warranty period but within 2 years of the purchase, with a replacement cost of $350. If they offer a 2 year extended warranty for $48, what is the company's expected value of each warranty sold? Where did the confrontation between the North Carolina militia and the Regulators take place ? A. Raleigh B. Durham C. New Bern D. Near the Village of Alamance ? Directions: Fill in the bianks with the correct answer Answers are provided in the box below.(Shimmer)(Effect Rebab)(Islam)(Hindu)(Metallophone)(Bonang)(Kendang)(Pelog)(ColotomieStructure)(Slendro)(Gong Ageng)1.The___________is the rackgong of Gamelan2.when Indoneslans want to express happiness in the piece they commonly use the__________tuning3.__________is the cyclical playing of music, in which each cycle is marked by aperiodic punctuation4._________is a distinct element found in Balinese Gamelan music in which a pair of gongs, one of them de-tuned, is played together, creating a sound similar to a tremolo5.___________is the dominant religion in Java6.___________is the term for an idiophone made of metal7.____________is the drum used for Gamelan.8.___________is the Indonesian fiddle used in gamelannusic9. Gong Kabyaris tied to the__________religion10 The_________is the instrument that usually punctuates each cycle in the colotomicstructure of Gamelan musicPlease help need kolang po The cost to rent a construction crane is $1200 per day plus $150 per oh use. Your budget for one-day crane rental is a most $3600