The lab setup shows four test tubes. Tube 1 contains water only. Tube 2 contains a live snail. Tube 3 contains a live green water plant. Tube 4 contains both a live green water plant and a live snail.

In this setup, which tubes contain at least one organism carrying on cellular respiration?
A) Tubes 1 and 2 only.
B) Tubes 2 and 4 only.
C) Tubes 3 and 4 only.
D) Tubes 2, 3, and 4 only.

The Lab Setup Shows Four Test Tubes. Tube 1 Contains Water Only. Tube 2 Contains A Live Snail. Tube 3

Answers

Answer 1

Answer:

D

Explanation:


Related Questions

Which of the following correctly identifies the function of the cell membrane?
A
controls what enters and leaves the cell
B
produces protein and enzymes
C С
controls the cell function
D
stores genetic infromation for the cell

Answers

Answer:

a controls what enters and leaves the cell

Explanation:

2. Describe a situation in which unbalanced forces are acting on an object. What is the net force
on the object, and how does the net force change the motion of the object?

Answers

Answer:

The force is by putting the two same objects on both sides and the motion is the scale

The force is by putting the two same objects on both sides and the motion is the scale.

What do you mean by force?

In physics, a force is an influence that can change the motion of an object. A force can cause an object with mass to change its velocity, i.e., to accelerate. Force can also be described intuitively as a push or a pull.

The normal force acts in a direction normal to the surface interaction between objects. Friction is a force that opposes motion on surfaces. Other examples of non-fundamental forces include the elastic force, tension.

Force is the fundamental result of an interaction between two objects, while power is an expression of energy consumed over time (work), of which force is an element.

Learn more about force:

https://brainly.com/question/13191643

#SPJ2

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC


Highlighted letters are: ATACTACC

Answers

Answer:

1 and 5

Explanation:

https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question

Answer:

1.ATTAGC(ATACTAC)GGGC

5. ATGAATGC(ATACTACC)GGGC

Which factor is different between the tundra biome and a tundra ecosystem?
A. Soil moisture
B. Climate
C. Size
D. Type of plants

Answers

Answer:

b it is the climate

Explanation:

B the climate

Answer  C.Size

Explanation:

the reason why it is not climate is because the climate is the same. So as the soil moisture. The tundra biome is a bigger size than the ecosystem. The order from largest to smallest level of organism: biosphere,biome,ecosystem,community, population, and last organism.

Choose one carbon sink and explain how the carbon gets out of it.

Answers

Answer::

Explanation:

Which of the following is an example of a complex machine?
1. Pulley
2. Wedge
3. Scissors
4. Incline

Answers

3- Scissors are an example of a complex machine.

Answer:

A :3

Explanation:

Just did acceleratted ed. Hope this helps!

NEED ASAP


Which quality would make the question "What will make cows produce more milk?" a good scientific question for a
biologist to investigate?
A) It is about living things and is testable.
B) It will help consumers save money.
C) It will lead to new technology to gather milk.
D) It is a question that can have many answers.

Answers

Answer:

D

Explanation:

The scientist could find new tech, which could lead to lower prices, also, it is about living things and testable, so it would be many answers.

science is so confusing to me!

Select all answers that are correct.

If people have never observed matter (mass) to be created or destroyed, then using inductive reasoning, it would be logical to conclude that:


the known laws of science cannot account for the origin of mass
the amount (quantity) of mass in the universe has never changed
the mass of the universe must have created itself

Answers

Answer:

second one.

Explanation:

not sure but it's the only answer that goes with the other laws

A cell membrane has permeability, which means that the membrane:

Answers

Answer:

transport proteins are specific and selective for the molecules they move, and they often use energy to catalyze passage.

Explanation:

I barley know what your trying to say

What is the use of tail in human sperm?​

Answers

It’s an adaptation that allows the sperm to travel to the egg more efficiently as the distance is long and most sperm do not make it to the egg so this increases the chance of fertilisation.

Explanation:

What does “denature” mean in terms of protein structure?

Answers

Explanation:

Denaturation, in biology, process modifying the molecular structure of a protein. Denaturation involves the breaking of many of the weak linkages, or bonds (e.g., hydrogen bonds), within a protein molecule that are responsible for the highly ordered structure of the protein in its natural (native) state.

Which of the following is a term use to describe a mound, hill of ridge of wind-blown sand?
A.peak
B.hill
C.contour
D.dune​

Answers

The answer is D.dune

Write a one-paragraph essay that summarizes the relationship between chloroplasts and
chlorophyll, making sure to include how they work together in photosynthesis.

Answers

Answer:

New algorithms for estimating chlorophyll-a in the Spanish waters of the Western Mediterranean Sea from multiplatform imagery This manuscript proposes a set of multi-sensor chlorophyll-a empirical algorithms for improving current estimates of chlorophyll-a concentration in two distinct regions in the Mediterranean Sea.

Many studies in the area of cancer research are opening up new possibilities for cures and prevention measures.  One area of research is directed at the effects that chlorophyll may have on cancer cells within the human body.  Research is being conducted to investigate whether chlorophyll has important cancer fighting factors that may play a role in the destruction of cancer cells or whether it is an effective preventive agent.  

Daily supplements of the chlorophyll derivative, chlorophyllin (CHL) can provide a way to prevent cancer by reducing DNA damage  (Arbogast, 1995).   The chlorophyllin copper complex (CHL) is a water-soluble version of chlorophyll and is a semi-synthetic prepared substance.  CHL is the most common chlorophyll derivative used for cancer related studies  (Chernomorsky, 1999).  Most research was done using chlorophyllin because chlorophyll is chemically modified to chlorophyllin in the body during digestion. Chlorophyllin given in amounts to that of chlorophyll were equally effective in the studies  (Sarkar, 1994).  CHL can be added to the diet very easily and may be safe and useful for effective prevention of cancer  (Arbogast, 1995).

Explanation:

Hope this is what you wanted.

Example of reproduction

Answers

Answer:

a deer giving birth to a baby deer

At what temperatures can monarch fly?

Answers

Answer:55 degrees

Explanation:In order for an adult monarch to fly, temperatures need to be above 55 degrees Fahrenheit.

Answer:

Temperatures need to be above 55 degrees Fahrenheit.

Explanation:

Please put the following in order from Least Inclusive to MOST inclusive...

Organs Molecules Organ Systems
Organism Cells Tissue

A) Organism -> Organ Systems -> Organs -> Tissue -> Cells -> Molecules
B)Atoms -> Cells -> Molecules -> Organs-> Organ Systems -> Organism
C) Molecules -> Cells -> Tissue -> Organs -> Organ Systems -> Organism
D) Cells -> Organism-> Tissue -> Organ Systems -> Molecules -> Organs

Answers

Definitely C. A has it reversed, B includes atoms and puts molecules after cells, and D puts organisms right after cells

What are the differences between the Big Bang Theory and the Steady State Theory?

Answers

Answer

One is a move and the other is a part of a state.

Explanation:

Answer:

The only difference, he explained, was that in the big bang scenario all the matter was created in one explosive beginning.

What is a carbon producer

Answers

Answer:

There are many many things in the world that produces Carbon. The largest source of greenhouse gas emissions from human activities in the United States is from burning fossil fuels for electricity, heat, and transportation. All of these produce Carbon into the atmosphere and warm the planet

Which of the following is caused by bad genes? *

Carcinoma
herpes
athlete's foot
vitaligo
bubonic plague

Answers

The answer is Vitaligo because all of the other answers are ones that you develop and not something you’re born with

What field of forensics do medical coroners work in?
O Forensic sociology
O Forensic pathology
O Forensic entomology
O Forensic psychiatry

Answers

the answer should forensic pathology :) my apologies if wrong but that should be it

Answer:

THE ANSWER is B

Explanation:

i need to poop

What’s the answer ????????

Answers

it’s d
i looked it up and it’s the exact same:)

Answer:

D: Electrons are transferred from one atom to another.

Explanation:

Protons are not involved in the covalency, and C, electrons are shared between two atoms, is the definition of a covalent bond, such as water. Ionic bonds form when two atoms, share (transfer) electrons to one another in order to fill the outer electron ring.

Hope this helps!

which statement best describes the forces in the picture?
a. The applied force in the force of friction are balanced.
b. all four forces are the same size.
c. all four forces are acting in the same direction.
d. The applied force in the force of friction are unbalanced.​

Answers

Answer: Its A.

Explanation:

None

The applied force and the force of friction are balanced in the picture because of which the person is standing still. Therefore option (A) is correct.

What is force?

A change in the force that is applied to an item with mass will cause that thing to move at a different speed. A body's state of rest or motion can be altered by the application of an external agent known as force. It is significant in both magnitude and direction.

The term "frictional force" refers to the force that is produced when two surfaces come into contact with one another and then slide against one another. A few factors that affect the force of friction are as follows: These forces are primarily influenced by the surface texture as well as the amount of force that is drawing them closer together.

Learn more about force, here:

https://brainly.com/question/13014979

#SPJ5

Which accurately labels the cytoplasm?
w
Х
Y
Z

Answers

Answer:

Y is the answer

Explanation:

I am 100%sure that the answer is Y

what is human intercose

practical of human intercose​

Answers

Answer:

Sexual intercourse, also called coitus or copulation, reproductive act in which the male reproductive organ (in humans and other higher animals)

please help me, 50 points

What type of bond are the arrows pointing to below in the picture


Answers

Thats is euther hydrogen bond or oxyegn bond. Im leaning towards hydrogen bond

which of the following statements are true?
A. Flavr Savr tomatoes are still commercially successful.
B. A large percentage of US crops are currently genetically engineered.
C. Glyphosate kills all plant life, even genetically altered plants.
D. None of these are true

Answers

B! we had to alter them to our preferred taste and nutrients

Explain the law's of segregation and independent assortment.

Answers

Answer:

The law of segregation states that the two alleles of a single trait will separate randomly, meaning that there is a 50% either allele will end up in either gamete. This has to do with 1 gene. The law of independent assortment states that the allele of one gene separates independently of an allele of another gene.

Explanation:

I know it late but can u plz mark me brainliest?


What problems can pseudoscience cause for society?

Answers

Answer:

It is quite difficult to picture a pseudoscientist—really picture him or her over the course of a day, a year, or a whole career. What kind or research does he or she actually do, what differentiates him or her from a carpenter, or a historian, or a working scientist? In short, what do such people think they are up to?

… it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

The answer might surprise you. When they find time after the obligation of supporting themselves, they read papers in specific areas, propose theories, gather data, write articles, and, maybe, publish them. What they imagine they are doing is, in a word, “science”. They might be wrong about that—many of us hold incorrect judgments about the true nature of our activities—but surely it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

PLEASE HELP ME I DONT KNOW THE ANSWER!!!!!

Answers

Answer: I think the answer is ( d) because the two tails are together to get stuck in the membrane as the picture shows

Explanation:

Question 6 of 20
A girl swings a yo-yo around in circles. How can she increase the total energy
of this system?
O
A. Reverse the direction of the swing,
O
B. Stand on a table while swinging the yo-yo.
C. Sit on the ground while swinging the yo-yo.
о
D. Swing the yo-yo at a lower speed,
SUBMIT

Answers

Answer:

it's B

Explanation:

A girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

What is Yo-yo?

Yo-yo may be defined as a type of toy that consists of a pair of joined discs with a deep furrow between them in which thread is attached and wound.

By reversing the direction of the swing, swinging the yo-yo at a lower speed, and sitting on the ground while swinging the yo-yo decrease the total energy of the system. This is because the system does not have the momentum that is required to increase its overall energy.

Therefore, a girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

To learn more about Total energy of the system, refer to the link:

https://brainly.com/question/478253

#SPJ5

Other Questions
If 999 is divided by 4, what is the remainder? What are the informal words in this sentence? He's starting to tick me off.Write it in a formal sentence What does the survival of Homo sapiens tell us about humans and their ability to adapt and change? and can i get a simple awnser pls 3. Photographs in which live people posed with deceased family members were once popular.TrueO False what are the factors that make the planet habitable Choose the equation for the graph By waging the Gallipoli campaign, the Allies hoped toO reinforce Albanian and Serbian borders.O protect shipping routes to Russia.O seize control of colonies in Australia.O block German troops from Greece. name two original subcultures of Mexico why did Iran experience almost 80 times more deaths in the 20th Century than California, despite having the same seismicity? Select all of the ratios that are equivalent to 8:6 Determine whether the following rates are equal or not using unit rates: 60 units in 3 minutes and 80 units in 4 minutes Liz watches a movie that is 105 minutes long how long is the movie Order the following list from least to greatest.|-18|, -30, 35, -9.3 En la clase del __________________grado est la maestra que me gusta.trecetrestercertrescientos What is the equation to pi (math) How does oral tradition differ from a written source? How do both help preserve history?Question 2How do sources help us to learn about the past? Match each definition of the word literal with the sentence that best illustrates its meaning.reproduced word for wordfree from exaggeration or embellishmentsticking to the primary meaning of a termrelating to or expressed in lettersSentencesDefinitionsThe witness told the literal truth before the judge>The common text LOL lacks a literal meaningThe translation device gave a literal translationEquality in the literal sense is unreasonable. aluminium oxide has a very high melting point (2072 degrees C) while carbon dioxide has a very low boiling point (-57 degrees C). Explain this difference clearly.Please help I dont get what its asking!!! which expert is an example of indirect characterization PLEASE HELP ME I DONT KNOW THE ANSWER!!!!!