PLEASE HELP! I WILL GIVE BRAINLIEST! Doug bought a meal in a town that has no sales tax. He tips 20%. Select all meals that Doug could buy for $20 or less. SELECT ALL CORRECT ANSWERS
A.$17.15
B.$16.50
C.$16.80
D.$16.65
E.$15.25
F.$17.00

Answers

Answer 1

Answer: E and B are the right answer I think tell me if im wrong :)


Related Questions

The rate of change increased by about _____ bass per a year. Round to the nearest tenth

Answers

From the exponential function, the average rate of change from year 1 to year 4 is 62.43, the average rate of change from year 5 to year 8 is 67.57 and the rate of change per year is 65

What is Exponential Function

An exponential function is a type of function that involves a variable in an exponent. It is of the form f(x) = a⋅b^x where a and b are constants and b > 0, b ≠ 1. The input to the function, x, is the exponent that the base, b, is raised to. The output, f(x), is the result of raising the base to the exponent.

In this problem, we have to calculate the rate of increase per year.

Data;

rate = 2%

P = 3000

The exponential growth can be calculated by;

A = P(1 + r)ⁿ

In year 1

A = 3000(1 + 0.02)¹

A = 3060

In year 4

A = 3000(1 + 0.02)⁴

A = 3247.3

a)

The average rate of change from year 1 to year 4 will be

A = [3000(1 + 0.02)⁴ - 3000(1 + 0.02)¹] / 4 - 1

A = 62.43

The average rate of change from year 1 to year 4 is 62.43

b)

The average rate of change from year 5 to year 8 is calculated as

A = [3000(1 + 0.02)⁸ - 3000(1 + 0.02)⁵] / 8 - 5

A = 67.57

C)

The rate of change increase can be calculated as;

A = [3000(1 + 0.02)⁸ - 3000(1 + 0.02)¹] / 8 - 1

A =65

Learn more on exponential function here;

https://brainly.com/question/2456547

#SPJ1

Which of the following statements must be true based on the diagram below?
Select all that apply. (Diagram is not to scale.)

Answers

As a result, after studying the diagram below of triangle and considering the reasons that follow, the appropriate answers are 1, 2, 3, and 4.

Define triangle.

Any three points in a plane can be connected to create triangles, which are polygonal (shapes) with three sides and three angles. They are among the first shapes in geometry that are explored. Since each polygon (with 4, 5, 6, or n sides) may be divided into triangles, triangles are particularly significant.

Here,

A segment bisector in this case is 1)OP.

Since segment LKMN is not divided into two equal sections, NO OP is not a segment bisector.

A perpendicular bisector is

2)OP.

NO,Because a perpendicular bisector creates an angle to the normal and divides a segment into two equal halves, OP is not a perpendicular bisector.

The angle bisector NO is OP.

Due to the fact that OP they do not divide any angles into two equal pieces.

4) The diagram's vertex of a pair of congruent angles is O.

YES Since O lines connect two angles with the same degree ()

5)O is the right angle's vertex.

NO

As a result of things not being at a straight angle.

6) A segment's midway in the diagram

By drawing diagonals across the four vertices LMNK, it is possible to determine where this segment's midpoint lies.

To know more about triangle, visit

https://brainly.com/question/2773823

#SPJ1

write the equation of the line that passes through the pointe (-6,1) and (2,5).

Answers

Answer:

y=1/2x+4

Step-by-step explanation:

m = y2-y1/x2-x1 = 5-1/2-(-6) = 4/8 = 1/2

since you have the slope, graph the points and find the y-intercept.

y=1/2x+4

salve for y √(7-x)²+(9-y)²

Answers

The solution for y in the equation √(7 - x)² + (9 - y)² is infinite many solutions

How to determine the solution for y

From the question, we have the following parameters that can be used in our computation:

√(7-x)²+(9-y)²

Express tthe equation properly

So, we have the following representation

√(7 - x)² + (9 - y)²

The above is an expression, not an equation

This means that the value of the variable y can take any value and the equation will be true

In other words, it means that the variable y has infinite many solutions because it is not an equation but it is an expression

Read more about expression at

https://brainly.com/question/15775046

#SPJ1

Help me pleaseeeeeee

Answers

it’s basically just plugging in values
so,
12 + 7 = 19
3(7) = 21 + 4 = 25
4(4) = 16 - 10 = 6
(7)(4) = 28/2 (dividing by two is the same and multiplying by 1/2) = 14

HELLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLP

Answers

Write a letter to your friend describing your hobbies. (80 words)A2/32, Chengal Nagar

Tambaram

Chennai – 600023

May 5, 2021

Dearest Malu,

I hope this letter finds you in the best of health. I received your letter the other day asking how I am spending my leisure time these days.

I have developed many hobbies over the years but collecting stamps and embroidery have been my favourite so far. Stamp collection is something I started as a kid. I had just taken a few pages off my notebook and made it my stamp book. I get so excited every time I see the postman. I wait to see what kind of stamp I will get. Knowing that I have a liking for collection of stamps, my cousins have been sending it across to me every time they find a different stamp. I can’t wait to show you my collection.

Embroidery is another hobby I picked up recently. I always liked embroidered clothes. I just started trying out different stitching patterns. Slowly, I learned almost everything, and now I am selling embroidered frames and dresses. It is so fulfilling to see a piece of work come out so well. I am sending you a gift along with this letter, something I made, as your birthday is fast approaching.

Hope to meet you soon.

Your dearest friend,

Renitaالسلام عليكماخوي عارض شريطPandemic

The number of views for a video on a social media website doubles every day. You begin observing the
number of views 8 days after the video was introduced. The number y of views x days after the video is introduced is
represented by the function = 22(2^x-8). When will there be one million views?

Answers

The total number of times social media browsers have been showed your content.

How is social media value calculated?

A general, but simplified earned media value formula is: EMV = impressions x cost per 1000 impressions x adjustable variable. The adjustable variable can be anything you are looking to track like engagement or impressions.

Simplifying

22 = 2(x + 8)

Reorder the terms:

22 = 2(8 + x)

22 = (8 * 2 + x * 2)

22 = (16 + 2x)

Solving

22 = 16 + 2x

Solving for variable ‘x’.

Move all terms containing x to the left, all other terms to the right.

Add ‘-2x’ to each side of the equation.

22 + -2x = 16 + 2x + -2x

Combine like terms: 2x + -2x = 0

22 + -2x = 16 + 0

22 + -2x = 16

Add ‘-22’ to each side of the equation.

22 + -22 + -2x = 16 + -22

Combine like terms: 22 + -22 = 0

0 + -2x = 16 + -22

-2x = 16 + -22

Combine like terms: 16 + -22 = -6

-2x = -6

Divide each side by ‘-2’.

X = 3

Simplifying

X = 3

To learn more about views Calculation to refer:

https://brainly.com/question/6239898

#SPJ1

speeeeeeeedddddddddddddddddddddddddddddddd

Answers

Answer:

I would be ...

75/8

multiple 9 by 8 and then add 3

Hope this helps!

Step-by-step explanation:

;)

Answer:

75/8!

Step-by-step explanation:

Which of the following fractions is equivalent to 10/12

Answers

Answer:

I don't know what the options are so I'm just gonna list a few and if they aren't on there lmk the options you have to choose from

Step-by-step explanation:

5/6, 15/18, 20/24, 25/30, 30/36, 35/42, 40/48, 45/54, 50/60, 55/66, 60/72, 65/78, 70/84, 75/90, 80/96, 85/102, 90/108, 95/114, 100/120

Answer:

5/6

Step-by-step explanation:

the equivalent fraction of 10/12 is 5/6 because both the numerator and the denominator are divisible by 2.

25 POINTS PLEASE ANSWER!
A fifth grader takes a standardized achievement test (mean = 125, standard deviation = 15) and scores a 104. What percent scored less than a 104? Go to z-table.com

Answers

HOPE IT WILL HELP YOU

====================================

====================================

z = 148 - 125

15

= 1.53

PLEASE LOOK AT THE ATTACHMENT

====================================

PLEASE MARK AS A BRAINLIST

====================================

There are 5 yellow golf balls, 3 red golf balls, and 10 white golf balls in a bag. What are the odds of randomly choosing a yellow golf ball?

Answers

Answer:

5/18

Step-by-step explanation:

Answer:

2

Step-by-step explanation:

1+1=2

Mr. Hart recorded the ratio of the minutes spent driving to the miles driven while on a road trip.

Miles Driven

Number of
Minutes Number of Miles
? 40
75 60
100 80

Which graph represents these pairs of values?

Answers

The graph representing the given pairs is represented by the equation y = (4/5)x + 40.

What is expression?In mathematics, an expression or mathematical expression is a finite combination of symbols that is well-formed according to rules that depend on the context.Mathematical symbols can designate numbers (constants), variables, operations, functions, brackets, punctuation, and grouping to help determine order of operations and other aspects of logical syntax.The general equation of a straight line is → y = mx + c

        {m} - slope                 {c} - intercept along the y - axis.

Given is that Mr. Hart recorded the ratio of the minutes spent driving to the miles driven while on a road trip.

The given table is as follows -

Number of Minutes {m} :      75         60

Number of Miles {M} :          100        80

The slope of this graph will be -

m = (80 - 60)/(100 - 75)

m = 20/25

m = 4/5

The equation of the line can be written as -

y = (4/5)x + c

For the point (75, 100) as follows -

100 = 4/5 x 75 + c

100 = 4 x 15 + c

c = 100 - 60

c = 40

The equation of the graph will be -

y = (4/5)x + 40

Refer to the graph attached.

Therefore, the graph representing the given pairs is represented by the equation y = (4/5)x + 40.

To solve more questions on expressing evaluation, visit the link below -

brainly.com/question/1041084

#SPJ1

Rahul performed an experiment using 16 windup rubber band single-propeller airplanes. He wound up the propeller a different number of times and recorded the amount of time (in seconds) that the airplane flew for each number of rotations that the propeller was wound. A regression analysis was performed and the partial computer output is given below.

The regression equation is
Time = 0.924 + 0.0462 Rotations

Predictor Coef SE Coef T P
Constant 0.9241 0.6413 1.44 0.172
Rotation 0.04625 0.01565 2.96 0.010

S= 0.5426 ; R-Sq= 38.4% ; R -Sq(adj) =34.0%

Required:
What is a 95 percent confidence interval for the slope of the regression line that relates the number of rotations the rubber band is wound and the plane's flight time?

Answers

Answer:

0.0462 ± 2.131(0.01565)

Step-by-step explanation:

The confidence interval for the slope, :

Slope Coefficient = 0.0462

Slope Coefficient ± Margin of error

Margin of Error = Tcritical * standard error

Standard Error (rotation) = 0.01565

We use T distribution, because sample size is small ; n = 16

Tcritical at 95% ; df = n - 1 = 16 - 1 = 15

Tcritical(0.05, 15) = 2.131

Hence,

Margin of Error = 2.131(0.01565)

Slope Coefficient for rotation = 0.0462

95% Confidence interval :

0.0462 ± 2.131(0.01565)

The 95% confidence interval for the slope of the regression line is 0.0462 ± 0.0333 or (0.01284, 0.07955)

What is the margin of error?

The probability or the chances of error while choosing or calculating a sample in a survey is called the margin of error.

Slope coefficient = 0.0462

Slope coefficient ± Margin of error

The margin of error will be given as

[tex]\rm Margin \ of \ error = T_{critical} \times standard \ error[/tex]

Standard error = 0.01565

We use T distribution because the sample size is small

[tex]\rm n = 16 \\\\T_{critical} \ at \ 95\% \ ; df = n-1 = 16- 1 = 15\\\\T_{critical} \ (0.05, 15) = 2.131[/tex]

Then we have

Margin of error = 2.131 × 0.01565

Margin of error = 0.0333

Then the 95% confidence interval will be

0.0462 ± 0.0333

More about the margin of error link is given below.

https://brainly.com/question/6979326

Given the number 254, 476, 951
What number is in the TEN THOUSAND's SPOT?

Answers

Step-by-step explanation: 1 is in the ten thousand places and has a place value of 10,000. 3 is in the thousand's place and has a place value of 3,000. 5 is in the hundreds and has a place value of 500.

Help PLZZ no files

Jessica's teacher asked her to create a histogram representing students and cell phone use.
Which would be the BEST question to obtain statistical data?
А
Are symbols used in your text messages?
B
How many text messages do you send each day?
с
Do you have an unlimited texting package on your phone?
D
In the past month have you sent over 100 text messages?
I’m

Answers

Answer:

B.

Why?

Step-by-step explanation:

"Jessica's teacher asked her to create a "histogram" representing students and cell phone use."

the hint histogram means the history or record of

HOPE IT HELPS

(FROM CROSS)

Can anyone tell me why this is wrong

Answers

Answer:

i, n, e, q, u, a, l, t, y

Step-by-step explanation:

You repeated some letters.

pls give me brainliest and have a nice day! Hope it helps!

Refer to the diagram shown.

I need help with this please help me

Answers

Answer: Angle-Side-Angle Theorem

Step-by-step explanation:

The two triangles are shown to have congruent angles. By the Reflexive Property of Congruence, Side PM is shared and congruent between the two.

Because the angles are on either side (left and right) of the shared side, the triangles are congruent by the Angle-Side-Angle Theorem.

It takes 3 eggs to make a cake .how many cakes can you make with 37 eggs

Answers

Answer:

12 cakes

Step-by-step explanation:

37 / 3 = 12.33333

If f(x)=-4x-5 and g(x)= 3-x, what is g(-4) +f(1)?

A.-10
B.7
C.-9
D.-2

Answers

Answer:

-2

Step-by-step explanation:

sustitue -4 into x for 3-x which would equal 7 because a negative times a negative equals positive. Then substitue 1 in for x in -4x-5 which would get you -9

give brainliest pls

What is the range for this set of data? 38, 17, 55, 40 02 38 39 O 72​

Answers

Answer:

38

Step-by-step explanation:

The range is the difference between the highest value and the lowest value. Here the highest value is 55 and the lowest 17. Therefore, the range is take away 17 from 55 which equals to 38

The range for this set of data is 38.

Option B is the correct answer.

What is range in a set of data?

The range is a measure of dispersion or spread in a set of data.

It is defined as the difference between the largest and the smallest values in the data set.

Range provides an idea of how much the data values are spread out or dispersed.

If the range is small, it indicates that the data values are close together, while a large range indicates that the data values are spread over a wider range of values.

We have,

To find the range of a set of data, we need to subtract the smallest value from the largest value.

Here, the smallest value is 17 and the largest value is 55.

So,

The range of the data set is:

55 - 17 = 38

Thus,

The range for this set of data is 38.

Learn more about range here:

https://brainly.com/question/15953457

#SPJ7

help please! include how you did it and i will give you brainilist.

Answers

Answer: A' (3, 6)

Step-by-step explanation: It is given that the point at is at the coordinate of (1, 2). In this coordinate, 1 represents the x-coordinate while 2 represents the y-coordinate. All you have to do is plug the values of x and y into (x+2)(y+4); so, it will look like this, (1+2)(2+4). Therefore, the new x-coordinate is 3 and the new y-coordinate is 6, so A'(3, 6).

How is the graph of y = −3x^2 − 8 different from the graph of y = −3x^2
a. It is shifted 8 units left.
b. It is shifted 8 units up.
c. It is shifted 8 units down.
d. It is shifted 8 units right.

Answers

Answer:

C shifted 8 units down

Step-by-step explanation:

The slope (part with x) lets us know its negative, the second number lets us know the y intercept.

SO since the original has no second number the y intercept is 0 but since the new equation is -8 it means its 8 units lower than 0 hence -8

35×75(46×13-55)-76=?​

Answers

Answer:

1,425,299

Step-by-step explanation:

Answer:

1425299

Step-by-step explanation:

35×75(46×13-55)-76

multiply stuff in parenthesis

35×75(598-55)-76

subtract stuff in parenthesis

35×75(543)-76

multiply

1425375-76

subtract

1425299

5 in. 3 8 in. What is the volume, in cubic inches, of the prism? cubic inches​

Answers

Answer:

70in^3

Step-by-step explanation:

Ok so the the formula for volume for a cube is V= L x W x H

so if the dimensions are 5in by 3in by 8in, the volume of the cube is 5x8x3 = 70 inches^3

8. Laurie graphed two lines, as shown on the right.
One line has a slope of -2 and the other has a slope of
1/2. Laurie noticed that although the slopes are
negative reciprocals of each other, the lines do not
appear to be perpendicular. Explain why this result
occurs, even though she graphed the lines correctly.

Answers

It's possible that the lines do not appear to be perpendicular, even though the slopes are negative reciprocals, because the lines may not be intersecting at 90 degrees angle,

What are the slopes of the two lines?

The slope of a straight line between two points says (x1,y1) and (x2,y2) can be easily determined by finding the difference between the coordinates of the points. The slope is usually represented by the letter m.

The slopes of the two lines that Laurie graphed, -2 and 1/2, are negative reciprocals of each other, which means that their product is -1.

In a Cartesian coordinate system, lines that are perpendicular to each other will have slopes that are negative reciprocals of each other, and the product of their slopes will be -1.

However, it's possible that the lines do not appear to be perpendicular, even though the slopes are negative reciprocals, because the lines may not be intersecting at 90 degrees angle.

The two lines could be skew lines that never intersect and thus cannot be perpendicular.

Another reason could be that the lines may not be in the same coordinate system or not graphed on the same set of axes.

When working with slope, we always assume that the lines are defined on a 2D Cartesian coordinate system, if that is not the case, it could cause the lines to not appear as perpendicular.

Hence, it's possible that the lines do not appear to be perpendicular, even though the slopes are negative reciprocals, because the lines may not be intersecting at 90 degrees angle, another reason could be that the lines may not be in the same coordinate system or not graphed on the same set of axes.

To learn more about the slopes of the two lines visit,

https://brainly.com/question/29250482

#SPJ1

Debby deposits 25% if the money that she earns each week in a savibgs account if debby earns $72 each week, how much money will she deposit next week

Answers

$18 is the answer

($72 x 25%)

Review the diagram of a locket in the shape of an ellipse.
The major and minor axes are labeled in the diagram.
If the center of the locket is at the origin of a coordinate
plane, which equation represents the locket?
x2
361
+
72
= 1
169
OK
V2
361
+
X2
= 1
169
38 mm
x2
1.444
1
676
26 mm
0 ' '
x2
676
= 1
1,444

Answers

Answer:

D

Step-by-step explanation:

If a = 38 and b = 26 then the equation would be y^2/1444 + x^2/676 = 1

also just graph it or smth

The equation of the ellipse in the figure is x^2/676 + y^2/1296 = 1

How to determine the equation?

The figure is an ellipse, and it has the following parameters:

Center, (h,k) = (0,0)Major radius = 36Minor radius = 26

The equation of the ellipse is then calculated using:

x^2/r^2 + y^2/R^2 = 1

So, we have:

x^2/26^2 + y^2/36^2 = 1

Evaluate the exponents

x^2/676 + y^2/1296 = 1

Hence, the equation of the figure is x^2/676 + y^2/1296 = 1

Read more about ellipse at:

https://brainly.com/question/16904744

#SPJ2

I’ll mark brainlist
NO LINKS

Answers

The right answer is 12

Answer:12

Step-by-step explanation: multiply the second fraction by 3 on the top and bottom to equalize the tow fractions denominators

You find a mutual fund that offers approximately 6% APR compounded
monthly. How much will you need to invest each month for the next year in
order to have $1000?

Answers

Answer:

$81.06

A P E X :)

Each other 11 letters of the word mathematics with written on a separate piece of paper and placed in a bowl what is the probability of drawing

Answers

Therefore, the probability of drawing "OBJ" from the bowl is (1/11) * (1/11) * (1/11) = 1/1331

Define Probability.

The area of mathematics known as probability deals with numerical representations of the likelihood that an event will occur or that a statement is true. An event's probability is a number between 0 and 1, where, broadly speaking, 0 denotes the event's impossibility and 1 denotes certainty.

Define Statistics.

The study of statistics focuses on gathering, organizing, organizing, analyzing, interpreting, and presenting data. It is customary to start with a statistical population or a statistical model to be researched when applying statistics to a scientific, industrial, or social problem.

The word "mathematics" has 11 letters, so there are 11 letters in the bowl. The probability of drawing the letter "O" is 1/11, since there is only 1 "O" in the 11 letters. Similarly, the probability of drawing the letter "B" is 1/11, and the probability of drawing the letter "J" is 1/11 as well.

Since the events of drawing the letter "O", "B", and "J" are independent of each other, the probability of drawing all three letters in order is the product of their individual probabilities.

Therefore, the probability of drawing "OBJ" from the bowl is (1/11) * (1/11) * (1/11) = 1/1331

It is a very low probability, the chances of drawing that sequence are very low.

To learn more about statistics visit:

https://brainly.com/question/29093686

#SPJ1

Other Questions
she is drinking water change into negative Find the x and y Intercept of x + 2y = -14 What is human trafficking Which of the following statements best explains differences between the finches? A. Some finches were born with beaks that allowed them to have better access to different sources of food. These finches reproduced and passed on their genes.B. The beaks of the finches changed so all of the finches could eat the same types of food.C. The beaks of the finches changed as the species of finches migrated to the same island.D. The beaks of the finches changed as the finches' body sizes changed. The characteristics of type one diabetes Factor quadratic trinomials2x^2+7x+63x^2+5x+2With method X pleaseee:( How do you graph a parent graph? Do you agree with Wittgenstein that philosophy should focus on language? Why or why not? Cultural differences that might influence the guest service experience include all of the following except diet greetings humor marriage What was the Selective Service Act and how did it impact the war? When considering the various resources factors of production which of the following is most likely to represent capital? Find the area. The figure is not to scale You can NOT have an in group without having an out group True False 3 chairs and 4 tables cost rs 7540. if the price of a chair is 220 find the price of table?ans - 7120 two equivalent ratios for 17:5? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA The table below shows information about how many fans there were at twofootball matches in a local tournament.What is the difference between the number of away fans at the semi-final and atthe final?Semi-finalFinalTotal number of fans250400Ratio of home fansto away fans6:47:3 Follow the constitution and the law even if I disagree with it what power or duty is this listed on Nika rolls an 8-sided cube with faces numbered 1 through 8. Which of the following statements is true? P(even number) = P(odd number) = P(number less than 8) = 1P(the number 9) = 1 Why might Great Britain's colonies have contributed tothe start of Ine Industrial Revolutionin Great Britain?