mendeleev is given the most credit for the concept of a periodic table of the elements because:

Answers

Answer 1

Mendeleev is given the most credit for the concept of a periodic table of the elements because he emphasized its usefulness in predicting the existence and properties of unknown elements.

What is Periodic table?

This is referred to as a tabular arrangement of the chemical elements by increasing atomic number which displays the elements so that one may see trends in their properties.

It consists of a rows and columns arrangement of the chemical elements and each they are grouped according ti the similar features which are present in the elements.

Mendeleev was the scientist who was given the most credit for the concept of a periodic table of the elements despite others working on it previously as a result of his emphasis in its usefulness in predicting the existence and properties of unknown elements.

Read more about Periodic table here https://brainly.com/question/1173237

#SPJ1


Related Questions

The table below describes geological events.

Event Boundary where they occur
Convergent Divergent Transform
A Yes Yes No
B Yes Yes Yes

Which statement is most likely correct? (1 point)

a
Event A represents earthquakes and Event B represents volcanic eruptions.

b
Event A represents volcanic eruption and Event B represents earthquakes.

c
Event A represents formation of ocean basins and Event B represents earthquakes.

d
Event A represents earthquakes and Event B represents formation of ocean basins.

Answers

Based on this table which describes geological events, a statement that is most likely correct include the following: B. Event A represents volcanic eruption and Event B represents earthquakes.

What is a divergent boundary?

Generally speaking, a divergent boundary is characterized by plates that are moving apart from one another, as well as basaltic volcanism and seafloor spreading. Also, a typical example of a divergent is the Mid-Atlantic Ridge.

In this context, we can reasonably infer and logically deduce that Event A is a geological event which most likely represents volcanic eruption because it occurred at both convergent and divergent boundary.

Furthermore, a convergent boundary simply refers to a region where lithosphere or crust is sinking into the mantle. Also, an example of a convergent is a region where subduction zones or collisions occur such as the west coast of South America.

In conclusion, a transform boundary simply refers to a boundary that is normally devoid of volcanism, but allows for the occurrence of earthquakes.

Read more on earthquakes here: brainly.com/question/248561

#SPJ1

Given the equation below, What is the reducing agent?
NOTE: Only enter the element symbol. For instance: K, or Cr, or
O, or H.
K2Cr2O3 + H2O + S --> SO2 + KOH + Cr2O3

Answers

Answer:

Reducing agent - S

Explanation:

The equation for the reaction is given as;

K2Cr2O3 + H2O + S --> SO2 + KOH + Cr2O3

The balanced equation is given as:

2K2Cr2O7 + 2H2O + 3S → 3SO2 + 4KOH + 2Cr2O3        

The reducing agent can be obtained by comparing the oxidation number of the elements. Increase in oxidation number signifies a reducing agent

K:

Reactant - 1

Product - 1

Cr

Reactant - +2

Product - +3

O

Reactant -   -2

Product -    -2

H

Reactant - +1

Product - +1

S

Reactant - O

Product - +4

S has an increase in oxidation number hence it is the reducing agent.

Although Cr has an increase in oxidation number, it occurs as a compound.

Pls Help!
No links Please!
I also want an explanation
I will give brainliest​

Answers

Answer:

uhhhhh not sure i cant see it

Explanation:

How is Petroleum extracted? How do humans use it? What are the benefits?

Answers

Petroleum (also crude oil) is a fossil fuel. It is extracted by giant drilling machines with an oil rig. A steel pipe is placed in the hole to the newly drilled bore, holes are then made in the base to well enable oil to pass into the bore. Petroleum greatly bendiest humans and is used for electricity generation, heating, road oil, feedstocks, chemicals, plastics, synthetic medals and more. Without it we would have even half of what we have today with the new and advancing technologies.

An oxide of chromium crystallizes with the following unit cell (chromium = gray; oxygen = red)(Figure 1) .
What is the formula of the oxide?

Answers

An oxide of chromium crystallizes with the following unit cell (chromium = gray; oxygen = red)(Figure 1) --CrO3

In order to determine the formula of the oxide, we need to determine the ratio of chromium to oxygen atoms in the unit cell. From the provided unit cell, we can see that there is one chromium atom (gray) in the center of the unit cell, and four oxygen atoms (red) surrounding it. This gives us a ratio of 1:4 chromium to oxygen, which simplifies to a ratio of 1:4 or 1/5. Therefore, the formula of the oxide is CrO4.An oxide is a chemical compound that contains at least one oxygen atom and one other element. Oxides can be either inorganic or organic, depending on the element that is combined with oxygen. Inorganic oxides are compounds composed of a metal and oxygen. They can be further classified as acidic, basic or neutral depending on the oxidation state of the metal atom. Examples of inorganic oxides include water (H2O), carbon dioxide (CO2), sulfur dioxide (SO2), and nitrogen dioxide (NO2)

To learn more about oxide here:

https://brainly.com/question/9496279

#SPJ4

how do you solve a stoichiometry?

Answers

Answer:

Explanation:

Although stochiometry is very scary loking math it is very easy and and fun to learn.

First Balance the chemical equation (Meaning there are equal amounts of elements at end and begining

Second Convert your units to mols

mols are what allows for stochiometry math to work to know how to find the mols takes practice and knowing when to write the math.

Then from there is just knowing how to go from grams to kg or g to mg and etc

The solid xy decomposes into gaseous x and y: xy(s) m x(g) + y(g) kp = 4. 1 (at 0 °c) if the reaction is carried out in a 22. 4 l container, which initial amounts of x and y will result in the formation of solid xy?

Answers

The initial amounts of x and y required to form solid xy are 1 mol of x and 1 mol of y.

What is initial amount?

The initial amount is the starting point for any financial transaction.

In order to calculate the initial amounts of x and y that will result in the formation of solid xy, the following equation must be used:
nx = ny * (4.1/kp)
where nx and ny are the moles of x and y, respectively, and kp is the equilibrium constant of the reaction.
Given the information provided, we can calculate the moles of x and y:
nx = ny * (4.1/4.1) = ny
ny = (22.4 L * 1 mol/22.4 L) = 1 mol
Therefore, nx = 1 mol and ny = 1 mol.
This means that if the reaction is carried out in a 22.4 L container, the initial amounts of x and y required to form solid xy are 1 mol of x and 1 mol of y.

To learn more about initial amount
https://brainly.com/question/26988374
#SPJ4

A container contains a mixture of hydrogen, oxygen, fluorine, chlorine and nitrogen gases. The pressure of hydrogen is 85.42kPa. The pressure of oxygen is 3.2kPa. The pressure of fluorine is 22.65kPa. The pressure of chlorine is 55.4kPa. The pressure of nitrogen is 65.3kPa. What is the total pressure of the container

Answers

Answer:  The total pressure of the container is 231.97 kPa.

Explanation:

Given: [tex]P_{H_{2}} = 85.42 kPa[/tex],        [tex]P_{O_{2}} = 3.2 kpa[/tex]

[tex]P_{F_{2}} = 22.65 kPa[/tex],            [tex]P_{Cl_{2}} = 65.3 kPa[/tex]

Total pressure is the sum of pressure of each component of the gas present in a vessel or container.

Hence, total pressure of the container is calculated as follows.

[tex]P_{total} = P_{H_{2}} + P_{O_{2}} + P_{F_{2}} + P_{Cl_{2}} + P_{N_{2}}\\= 85.42 kPa + 3.2 kPa + 22.65 kPa + 55.4 kPa + 65.3 kPa\\= 231.97 kPa[/tex]

Thus, we can conclude that the total pressure of the container is 231.97 kPa.

What is an irony definition?

Answers

In literary classes, the three most popular types are verbal irony, dramatic irony, and situational irony. When a speaker or narrator says something that contradicts what they mean, what they intend, or what the context necessitates, this is called verbal irony.

What is irony?

One thing is expressed while another is meant in an ironic statement. For example, on a chilly, wet gray day, you would exclaim, "What a gorgeous day!" Alternatively, if you were suffering from a severe case of food sickness, you may respond, "Wow, I feel terrific today." "ffers points of view and ideas that are, at most, intriguing... However, it does not reach the truth." Ronagh and Souder are particularly concerned with scientific assertions that are not meant to be taken seriously.

Here,

The three most common varieties in literary studies are verbal irony, dramatic irony, and situational irony. Verbal irony occurs when a speaker or narrator says something that contradicts what they mean, what they intend, or what the context requires.

To know more about irony,

brainly.com/question/1695719

#SPJ4

Name the sub atomic particles in part Z of a boron atom.Give the relative charges of these sub atomic

Answers

Answer:

proton 5+

electron 5-

neutron 0, neutral

Explanation:

Boron is the fifth element on the periodic table, meaning it's atomic# is 5. that is the # of protons. Protons have a positive chargé. The # of electrons in a neutrally charged atom is the same as the # of protons, because they're negatively charged. so if there are 5 protons, there are 5 electrons +5 + -5 = 0 chargé. The third subatomic particle is a neutron. It has a charge of 0, neutral, thus its name. You know there are 6 neutrons in a Boron atom because the atomic mass is 11. electrons have basically no weight, so 11 - 5 protons = 6 neutrons.

The subatomic particles in part Z of the boron atom are neutrons and protons. neutrons have a charge of zero while protons have a charge of +1. Note that Z represents the core of the boron atom.

The atom is composed of three fundamental subatomic particles which are;

ElectronsProtonsNeutrons

Protons and neutrons are found at the core of the atom. This core is the center of the atom. The protons and neutrons are found inside the nucleus or core of the atom and are collectively called nucleons. Electrons move round the orbits of the atom.

Protons are positively charged, electrons are negatively charged while neutrons have no charge.

Part Z is the nucleus or core of the atom and contains neutrons and protons.

Learn more: https://brainly.com/question/23453530

How many liters of. 225 M Na2S solution would be required to react completely with 81. 8 g Fe(C2H3O2)3? (The molar mass of iron (III) acetate is 233. 00 g/mol. )

Answers

0.002 liters of 225 M Na2S solution is required to completely react with 81.8 g Fe(C2H3O2)3

Starting from the balanced equation of the reaction and the molar mass of iron (III) acetate (Fe(C2H3O2)3, first the reacting moles of this compound are determined, then the amount of reacting moles of sodium sulfide (Na2S) is determined and finally the amount of solution that contains said amount of moles.

Balanced equation of the reaction

3Na2S + 2Fe(C2H3O2)3 → 6NaC2H3O2 + Fe2S3

Determination of liters of 225 M Na2S solution for a complete reaction

This determination is made in three steps:

Determination of reactant moles of Fe(C2H3O2)3Determination of the reactant moles of Na2SDetermination of the volume of solution with the number of reacting moles of Na2S

Determination of reactant moles of Fe(C2H3O2)3

If 233.00 g of Fe(C2H3O2)3 is equivalent to 1 mol of Fe(C2H3O2)3

So 81. 8 g Fe(C2H3O2)3 equals x mol of Fe(C2H3O2)3

X mol of Fe(C2H3O2)3 = 81. 8 g Fe(C2H3O2)3 x 1 mol of Fe(C2H3O2)3 / 233.00 g of Fe(C2H3O2)3

X mol of Fe(C2H3O2)3 = 0.351 mol

Determination of the reactant moles of Na2S

If 2 moles of Fe(C2H3O2)3 react with 3 moles of Na2S

Then 0.351 mol of Fe(C2H3O2)3 reacts with x mol of Na2S

X mol of Na2S = 0.351 mol Fe(C2H3O2)3 x 3 mol of Na2S / 2 mol of Fe(C2H3O2)3 = 0.526 mol

Determination of the volume of solution with the number of reacting moles of Na2S

If there are 225 moles of Na2S in 1 liter of solution

So there are 0.526 moles of Na2S in x liter of solution.

X liter of solution = 0.526 mol of Na2S x 1 liter of solution / 225 mol of Na2S = 0.0023 liters, that is, 2.3 ml

Therefore, 0.0023 liters of 225M Na2S solution is required.

Learn more about required liters of Na2S solution at https://brainly.com/question/24185902

#SPJ4

If the half-life of an isotope is 50 years, calculate the percent of original radioactive atoms that remain radioactive after 200 years.
A
none

B
50%

C
12.5%

D
6.25%

Answers

Answer:

A. none

Explanation:

after 200 years, it would be 100 years gone

50+50=100

In a given reaction, the rate may be expressed as either rate What must be true about X or Y if the reaction is proceeding in the forward direction

Answers

In a given reaction, the rate may be expressed as either the rate of formation of a product (X) or the rate of consumption of a reactant (Y). If the reaction is proceeding in the forward direction, the rate of formation of the product (X) will be positive and the rate of consumption of the reactant (Y) will be negative.

This means that X is being produced at a faster rate than it is being consumed and Y is being consumed at a faster rate than it is being produced.

Alternatively, if the reaction proceeds in the opposite direction, the rate of formation of products (X) is negative and the rate of consumption of reactants (Y) is positive. This means that X is consumed faster than it is produced, and Y is produced faster than it is consumed.

Learn more about the rate of reaction here: https://brainly.com/question/24795637

#SPJ4

Which statement best describes how two body systems work together to maintain homeostasis?

A) The respiratory system removes the waste produced by the digestive system.


B)The integumentary system produces white blood cells used by the muscular system.


C) The circulatory system moves oxygen throughout the body that is brought in by the respiratory system.


D) The nervous system digests food to produce nutrients for the body that is carried to the cells by the respiratory system.

Answers

Answer:

c. The circulatory system moves oxygen throughout the body that is brought in by the respiratory system.

Explanation:

The circulatory system delivers oxygen and nutrients to cells and takes away wastes.

The respiratory system is the network of organs and tissues that help you breathe.

So, of the options, option c is correct.

Hope this helps!

The  statement which  best describes how two body systems work together to maintain homeostasis is that circulatory system moves oxygen throughout the body that is brought in by the respiratory system.

What is homeostasis?

In biology, homeostasis  is the state of steady internal, physical, and chemical conditions maintained by living systems.This is the condition of optimal functioning for the organism and includes many variables, such as body temperature and fluid balance, being kept within certain pre-set limits (homeostatic range).

Other variables include the pH of extracellular fluid, the concentrations of sodium, potassium, and calcium ions, as well as the blood sugar level, and these need to be regulated despite changes in the environment, diet, or level of activity. Each of these variables is controlled by one or more regulators or homeostatic mechanisms, which together maintain life.

Learn more about homeostasis,here:

https://brainly.com/question/3888340

#SPJ6

Which of the following is always equal to the number of protons in an atom 1pc
of a given element?
Mass number
Olonic number
O Atomic number

Answers

Answer:

[tex]\huge\mathfrak\purple{answer..} \\ \\ \huge\mathfrak\green{atomic \: number} \\ \\ \huge\mathfrak\red{hope \: it \: helps...}[/tex]

Mr. Peter's apartment is on the 4th floor of his apartment building. He just purchased a new piano, and the only way to move it into his apartment is with a crane. A crane suspends the 150 kilogram piano 35 meters in the air, What is the piano's potential energy?​

Answers

Answer:

im here for the points

Explanation:

HAHA

What mass of mgo is produced from 2.00 moles of mg ? Mg +02 mgo

Answers

Chemical Reactions and Moles of Reactants and Products
That is, it requires 2 moles of magnesium and 1 mole of oxygen to produce 2 moles of magnesium oxide. If only 1 mole of magnesium was present, it would require 1 ÷ 2 = ½ mole of oxygen gas to produce 2 ÷ 2 = 1 mole magnesium oxide.

Propane gas (C3H8) is ignited. Type of reaction ________ ignition ___________________ Balanced chemical equation:

Answers

Propane gas (C3H8) is ignited. Type of reaction combustion ignition.

[tex]C_3H_8(g)+5O_2(g) < = > 3CO_2(g)+4H_2O(l)[/tex] Balanced chemical equation.

A balanced chemical reaction is what?

A chemical equation is said to be balanced if the quantity of each type of atom in the reaction is the same on both the reactant and product sides. In a balanced chemical equation, the mass and the change are both equal.

Propene is an alkene because why?

The parent chain is the longest chain of carbon atoms that contains the double bond. Its name has the same stem as an alkane with the same number of carbon atoms, but it is designated as an alkene by adding the suffix -ene. Propene is the resultant chemical, CH2=CHCH3.

What does a balanced chemical equation entail?

In accordance with the Law of Conservation of Mass, mass cannot be generated or destroyed in a chemical reaction. A balanced chemical equation has an equal number of atoms of each element on the left and right sides of the reaction.

To know more about chemical reaction visit:

https://brainly.com/question/11231920

#SPJ4

3. Nicotine, the addictive drug in cigarettes, contains 74.0% carbon, 8.6% hydrogen,
and 17.3% nitrogen. What mass of each element can be recovered from a 55.0-
gram sample of nicotine?

Answers

Answer:

the mass of each element can be recovered from is 162.23 grams

Explanation:

the mass really depends on the volume. If there is 74.0% carbon, 8.6% hydrogen and 17.3% nitrogen then you first cross out the 0 and 3 which leaves you with 17% and 74%. Then all you have to do is multiply 17% and 74% and then divided it by 8.6%.

The various drugs such as the nicotine as additive drug is a pack of cigarette consist of about 75 of the carbon, 8.6% of hydrogen and about 17.3% of mitogen.

The M of each elements that can recovered which is 162.23 gM really depends on the volume, then you 1st cross out the 0 and 3 which leaves you with 17% and 74%. Then we have to do is multiply 17% and the 74% and divided it by the 8.6%.

Learn more about the addictive drug.

brainly.com/question/2210950.

What are the 4 parts of an element box?

Answers

The element box contains name and symbol of the element, number of protons and electrons, atomic mass, and electron configuration.

Each key incorporates an detail's name, precise symbol, atomic weight and atomic variety. Oxygen, for example, has an atomic variety of 8, an atomic weight of 15.996 and a completely unique symbol, O.  Each container represents an detail and incorporates its atomic size, symbol, common atomic mass, and (sometimes) name. The factors are organized in seven horizontal rows, referred to as intervals or series, and 18 vertical columns, referred to as groups. The container containing every detail's records is called the detail key. The table is split into 4 more or less square regions referred to as blocks. The rows of the desk are referred to as intervals, and the columns are referred to as groups. Elements from the equal institution of the periodic table display comparable chemical characteristics.

To learn more about periodic table check the link below:

brainly.com/question/15987580

#SPJ4

Where is hydroelectric energy used?

Answers

Hydroelectric energy is a renewable form of energy used to generate electricity.

This energy is created by harnessing the power of moving water, typically from rivers and streams, to spin turbines and generate electricity.

Hydroelectric power plants are used to generate electricity for homes, businesses, and cities all over the world.

By utilizing the natural power of water, hydroelectric energy is a clean, safe, and reliable source of energy that helps reduce global carbon emissions. It is also a cost-effective energy source, making it a popular choice for many energy providers.

Hydroelectric energy is one of the most widely used sources of electricity in the world, with many countries heavily relying on it for their energy needs.

To learn more about hydroelectric, click here:

https://brainly.com/question/2321474

#SPJ4

The isotope of iodine with mass number 128 undergoes beta decay with a half-life of 25.00 minutes. The balanced nuclear reaction for this process is:

Answers

Beta decay occurs with a half-life of 25 minutes for the iodine isotope with mass number 128. For this procedure, 3→Te + iB is the balanced nuclear reaction.

Isotopes are two or more atom types that share the same atomic number (number of protons in their nuclei) and position in the periodic table (and, therefore, belong to the same chemical element). However, isotopes have different nucleon numbers (mass numbers) because they have varying numbers of neutrons in their nuclei. All isotopes of a given element have nearly identical chemical properties, but they differ in terms of atomic mass and physical characteristics.

The word "isotope" is derived from the Greek words isos, which means "equal," and topos, which means "place," meaning "the same location." The name refers to the fact that different isotopes of the same element occupy the same spot on the periodic table.

Learn more about isotope here:

https://brainly.com/question/12955625

#SPJ4

Match each item with the correct statement below.
Column A
1. Fluorine, bromine, or iodine
2. An element found in Group 1 of the periodic table
3. Sodium or cesium:
4. An element found in Group 17:
5. Magnesium or barium:
6. An element found in Group 2:
An element found in Group 2
Column B
a. Alkali metal
b. Alkaline earth metal
c. Halogen

Answers

Answer:

Explanation:

Flourine, bromine or iodine --> HalogenAn element found in group 1 of the periodic table --> Alkali metalSodium or cesium --> Alkali metalAn element found in group 17 --> HalogenMagnesium or Barium --> Alkaline earth metalAn elment found in group 2 --> Alkaline earth metal

Two spherical objects have masses of 8,000 kg and 5.0 kg. Their centers are separated by a distance of 1.5 m. Find the gravitational attraction between them.

Answers

The gravitational force of attraction between the two objects would be 1.1858 x [tex]10^{-6[/tex] Newton.

Gravitational force

The gravitational force of attraction between two objects of mass m1 and m2 is proportional to the product of the masses of the two objects and inversely proportional to the square of the distance between the two objects.

This is mathematically expressed as follows:

Gravitational force (F) = [tex]Gm_1m_2/d^2[/tex]

Where G is the universal gravitational constant and d is the distance separating the two masses.

In this case:

m1 = 8,000 kg

m2 = 5.0 kg

G = 6.67 x [tex]10^{-11[/tex] N m2 / kg2

d = 1.5 m

F = 6.67 x  [tex]10^{-11[/tex] x 8,000 x 0.5/1.5 x 1.5

  = 26680 x  [tex]10^{-11[/tex]/2.25

  = 11857.77 x  [tex]10^{-11[/tex]

   = 1.1858 x [tex]10^{-6[/tex] Newton

In other words, two spherical objects of masses 8,000 kg and 5.0 kg separated by a distance of 1.5 would have a gravitational force of attraction of 1.1858 x [tex]10^{-6[/tex] Newton between them.

More on the gravitational force of attraction can be found here: https://brainly.com/question/10405569

#SPJ1

As the earth rotates on its axis, the constellations and stars in them appear to

Answers

Move or rotate as well since they stay in place and we move.

At 161 K, SiH4 boils but SiO2 remains as a solid. Using principles of interparticle forces, explain the difference in boiling points.

Answers

The boiling point of a substance is determined by the strength of the interparticle forces between molecules.

What is boiling point?

Boiling point is the temperature at which a liquid changes state from liquid to gas, also known as its vaporization point. The boiling point of water at sea level is 100°C (212°F).

In the case of SiH4, the boiling point is higher than that of SiO2 due to the stronger nature of the intermolecular forces. This is because SiH4 is held together by stronger hydrogen bonds, resulting in more energy needed to break apart the molecules. On the other hand, SiO2 is held together by weaker dipole-dipole interactions and London dispersion forces, meaning it requires less energy to break apart the molecules and thus has a lower boiling point.

To learn more about boiling point
https://brainly.com/question/14008526
#SPJ4

The Ksp of SrSO4 is 3. 2 x 10^-7. What is the equilibrium concentration of a sulfate ion in a 1. 0 Dash L solution of strontium sulfate which 0. 10 mol of Sr(CH3CO2)2 has been added?

Answers

The equilibrium concentration of a sulfate ion is 32× 10⁻⁶M can be added in a 1. 0 Dash L solution of strontium sulfate which is 0. 10 mol of Sr(CH3CO₂)₂.

Solubility is defined as the maximum amount of a solute that can be dissolved in a known quantity of the solvent at a certain temperature is its solubility.

The solubility of SrSO₄ is:

SrSO₄(s) → Sr²⁺(aq) + SO₄²⁻(aq)

Where Ksp is defined as:

Ksp = 3.2x10⁻⁷ = [Sr²⁺] [SO₄²⁻]

The concentration of Sr is:

0.10mol / 1L = 0.10M = [Sr²⁺]

Replacing in Ksp:

3.2x10⁻⁷ = [0.10M] [SO₄²⁻]

[SO₄²⁻] = 3.2x10⁻⁶M

To know more about solubility here

https://brainly.com/question/28170449

#SPJ4

What is the purpose of photosynthesis?

make glucose
make light
release carbon dioxide
none of the above

Answers

The purpose is to make glucose.

Answer:

make glucose

Explanation:

During photosynthesis, plants trap light energy with their leaves. Plants use the energy of the sun to change water and carbon dioxide into a sugar called glucose. Glucose is used by plants for energy and to make other substances like cellulose and starch

A mixture of three gases has a total pressure of 365 mmHg. Gas A contributes a pressure of 53 mmHg and gas B contributes a pressure 185 mmHg. What is the partial pressure of gas C?

If you give explanation and answer, I will give you brainliest answer. :)

Answers

This one is the easiest law, but you would take 53 and 185 and add them together to get 235 and then you will minus 235 and 365 and the answer you are looking for is 130 mmHg! Hopefully this helped you!!

Write a balanced net ionic equation for a redox reaction that results in the formation of potassium chloride. (Assume that potassium chloride is not a starting material, and assume the reaction takes place in aqueous solution.)

Answers

2K + [tex]Cl_{2}[/tex] = 2KCl is the balanced net ionic equation for a redox reaction that results in the formation of potassium chloride.

Chlorine gas, Cl 2, will cause potassium metal, K, to burn, forming potassium chloride, KCl, an ionic molecule. This synthesis reaction is described by the following balanced chemical equation.

2K + [tex]Cl_{2}[/tex] = 2KCl

Consider this reaction to be a redox reaction as an alternative mental image. Here, chlorine gas is oxidizing potassium metal to produce potassium cations. Chlorine gas is converted into chloride anions during the process. The subsequent reaction between the potassium actions and the chloride anions will result in potassium chloride.

Learn more about Redox Reaction

brainly.com/question/13293425

#SPJ4

Other Questions
To pay for a $15,900 car, Donna made a down payment of $4800 and took out a loan for the rest. On the loan, she paid monthly payments of $245.70 for 4years.(a) What was the total amount Donna ended up paying for the car (includingthe down payment and monthly payments)?(b) How much interest did Donna pay on the loan? Is this correct? I can't figure out if this is, So please answer. streamlined transportation vehicle with 2 openings and glass windows. It appears to run on some kind of track.Predict what the text will be about based on this image?a.future transportationc.both of theseb.public transportationd.neither of these Sam has always been able to pick up new languages easily. What quality does she have that helps her do this?soft skills.self-awarenesscompetencyability What baseball stat does Lawrence Hinman suggest is the most important stat for determining the best player in the game in a given year Where should the comma go in the following sentence **You should not need to round on this problem, no %'s decimals only**At Houston Community College 60% of the students who take English will pass. Of those who pass English, 70% will also pass Accounting. Of those that do not pass English, 45% will still pass accounting. How do you find the 3rd side of a triangle? Select the correct answer. Which graph represents the solutions to this equation? x2 + 8x = -20 A. Linear-quadratic system graph shows upward parabola with vertex at (minus 2, 4) and passing through x and y-axis (minus 8, 0), and (0, 0) B. Linear-quadratic system graph shows upward parabola with vertex at (minus 4, 4) and passing through (minus 2, 8), and (minus 6, 8) C. Linear-quadratic system graph shows upward parabola with vertex at (4, 0) and passing through (1, 4), and (6, 4) D. Linear-quadratic system graph shows a downward parabola with vertex at (0, 8) which intercepts the x-axis at 3 and minus 3 units. Lila swam 50 meters north in 10 seconds. Find Lila's velocity TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets. True/False: Money is more important than finding something you're going to lovedoing. Select the correct answer.Which of these is an example of elemental carbon?A. DiamondB. MethaneC. Proteins 6 less than 3 times a number 42 what is the number Two numbers total 31 and have a difference of 9. Find the two numbers. Can someone help me with this question? Can someone please help me with math. The process by which keys are managed by a third party, such as a trusted CA, is known as?O Key escrowO Key destructionO Key renewalO Key management Which sentence best states the central idea of the account?A After the Civil War, the city of San Antonio prospered.B San Antonio is famous because of the Alamo.C Market Square is a large Mexican marketplace in San Antonio.D San Antonio is a thriving city with a fascinating history. Name the minor arcs in the circle Select all the minor arcs by their correct names.