how many electrons are on the move in a circuit where a current of 2.0 A flows for 2.0 minutes?

Answers

Answer 1

The number of electrons that move in a circuit where a current of 2.0 A flows for 2.0 minutes will be [tex]1.5X10^2^2[/tex]. The correct option is C.

What is current?

Electrical charge carriers, often electrons or atoms deficient in electrons, travel as current. The capital letter I is a typical way to represent current.

A current of 2A passes through a wire for 20 minutes. The number of electrons that crossed the cross-section in this period is

Given that,

Current =2A

Time t= 20min = 20×60s

Let,

n and e be the number and charge of electrons in time t.

So,

The total charge, q(say) in the wire is

q = ne

Hence, the current flowing in time t is

I = q/t

I = ne/t

n = It/e

[tex]n=\frac{2(20X60)}{1.6X10^{-19}} \\\\n=\frac{2400}{1.6X10^{-19}}\\\\n=1.5X10^{22}[/tex]

Thus, the answer is [tex]1.5X10^2^2[/tex], means the correct option is C.

For more details regarding current, visit:

https://brainly.com/question/13076734

#SPJ1

Your question seems incomplete, the missing options are:

[tex]1.5X10^{21}\\\\1.5X10^{20}\\\\1.5X10^{22}\\\\1.5X10^{21}\\\\1.5X10^{23}[/tex]


Related Questions

Part E
How much potential energy does the roller coaster have at the top
of the second hill2 Use your answers from parts C and D to
determine the answer.

Answers

Answer:  

416,500 J – 67,200 J = 349,300 J

The potential energy at the top of the second hill is 349,300 joules.

Answer:

The potential energy at the top of the second hill is the potential energy at the top of the first hill minus the potential energy lost from friction:

416,500 J – 67,200 J = 349,300 J

The potential energy at the top of the second hill is 349,300 joules.

Explanation:

This answer came straight from the website of Edmentum.

Which of the following reactions will delay the decay of a fruit?

Answers

Answer:

placing it in the refrigerator

a force applied to a 3kg mass over a distance of 7.5m, increase the velocity of the mass from 5m/s. calculate the magnitude of the force assume the force and the displacement of the mass are parallel​

Answers

The magnitude of the force assuming the force and the displacement of the mass is parallel​ is 10 N.

What is force?

An agent with the ability to change a body's resting or moving condition is known as an external force. It has a magnitude and a direction. The place where force is applied is called the application, and the direction in which it is applied is called the direction of the force.

The Force can be computed using a spring balance. The SI unit of force is Newton (N).

What is the displacement with an example in physics?

Displacement is the change in the location of an object independent of the direction it is traveling. Displacement is a vector quantity since it takes into consideration both the magnitude and the direction of an object's motion. As a vector quantity, displacement can have a positive, negative, or zero value.

Given:

m = 3kg

distance = 7.5m

Velocity = 5m/s

Now, we can calculate the time

Velocity = displacement/time

Time t = 7.5/5

Time t = 1.5s

F = ma

[tex]F = 3*\frac{v}{t}[/tex]

[tex]F = 3*\frac{5}{1.5}[/tex]

F = 3×3.33

F = 9.99

F = 10N

To know more about force visit:

https://brainly.com/question/12785175

#SPJ1

a 0.30g fly moving at 1.5ms-1 is trappedby a spiders web the fly comes to rest in a time of 0.40s calculate the magnitude of the change in momentum if the fly and the average firce exerted by the web on the fly​

Answers

Answer:

Magnitude of the change in momentum = 0.45kgms-1

Force exerted = 1.13N

Explanation:

The magnitude of the change in momentum of the fly can be calculated using the equation Δp = mv, where m is the mass of the fly and v is the velocity of the fly. In this case, the fly has a mass of 0.30g and an initial velocity of 1.5ms-1. Therefore, the change in momentum of the fly is

Δp = (0.30g) x (1.5ms-1) = 0.45kgms-1.

The average force exerted by the web on the fly can be calculated using the equation F = Δp/Δt, where F is the average force, Δp is the change in momentum of the fly, and Δt is the time taken for the fly to come to rest. In this case, the change in momentum of the fly is 0.45kgms-1 and the time taken for the fly to come to rest is 0.40s. Therefore, the average force exerted by the web on the fly is

F = (0.45kgms-1)/(0.40s) = 1.13N.

a book with a mass of 0.25 kg is lifted 2 m onto a bookshelf. how much gravitational potential energy does it gain? ( g = 10 N/kg)​

Answers

Gravitational Potential Energy = mass x gravity x height

(Gpe=mgh)

0.25 x 10 x 2 = 5J

A ball is thrown upward from the ground with an initial velocity of 2.13 m s-1. How long does the ball take (in millisecond, ms) to reach the maximum height

Answers

The time it takes for the ball to reach its maximum height is 745 milliseconds.

What is time?

Time is defined as a scalar quantity that describes the progression of events in the universe. It is often considered to be the fourth dimension of spacetime, along with the three dimensions of space. Time is closely related to the concepts of causality, or the relationship between cause and effect, and is considered to be a fundamental aspect of the physical universe.

To find the time it takes for the ball to reach its maximum height, we need to use the equation:

1/2 * a * t^2 + v * t + d = 0

where a is the acceleration due to gravity (-9.8 m/s^2), t is the time, v is the initial velocity (2.13 m/s), and d is the initial displacement (0 m, since the ball is thrown upward from the ground).

We know that the ball is thrown upward and reaches its maximum height, so it is subject to a constant acceleration due to gravity in the downward direction. Therefore, the acceleration is -9.8 m/s^2.

The time to reach the maximum height can be found by solving the above equation for t.

t = sqrt(-2*d/(a+v))

t = sqrt(-2*0/(-9.8+2.13))

t = sqrt(2*2.13/(9.8-2.13))

t = sqrt(4.26/7.67)

t = sqrt(0.555)

t = 0.745s

To get the time in milliseconds:

t = 0.745s * 1000ms/s = 745 ms

Therefore, the time it takes for the ball to reach its maximum height is 745 milliseconds.

To learn more about time from the given link:

https://brainly.com/question/26046491

#SPJ4

What is the process called when the ice reaches the coast breaks off to form icebergs that are then carried out to sea?

Answers

The process of breaking of ice from the edge of the glaciers and then carried out to sea is known as calving.

Calving of glaciers is usually accompanied by a loud cracking sound or booming sound.

A huge glacier or polar ice that has broken off and floated into the sea is what creates an iceberg. The iceberg is composed of fresh water, just like the glaciers or ice in the North Pole. Since freshwater is less thick than salty seawater, icebergs float in the water.

When a rift develops in a glacier's margin as a result of ice melting, wind or water erosion, or other factors that make the glacier unstable, the calving process begins. A block eventually separates from the land, forming an iceberg that crashes into the water.

To know more about icebergs:

https://brainly.com/question/11430987

#SPJ4


[tex] \huge\mathcal\colorbox{red}{\color{pink}{クエスト}}[/tex]
Explain,'The Theory of Relativity' briefly.​

Answers

Answer:

The theory of Relativity state that :Special relativity applies to all physical phenomena in the absence of gravity and General relativity explains the law of gravitation and its relation to other forces of nature.

Question ↷Explain,'The Theory of Relativity' briefly.Answer ↷Composed of two non correlative theories both given by ,'Einstein' , namely ,"Special relativity" & "General relativity".Special Relativity states that physics laws works the exact same for each and every inertial objects and also that light's speed in vaccum isn't dependent on the motion of it's respective observer.General Relativity states that Gravity dilates the time and It affects the spacetime by bends , stretches and compression .Time slips more leisurely where the gravity is strong and vice versa.

[ You're welcome,my past self!]

Two waves meet while traveling through the same medium. The crests of wave one meet up with the crests of wave two. If wave one has an amplitude of 4 and wave two has an amplitude of 3, what is the amplitude of the wave resulting from the interference

Answers

If wave one has an amplitude of 4 and wave two has an amplitude of 3, what is the amplitude of the wave resulting from the interference

Equation Used

The resulting intensity is calculated as follows: I = (sqrt(I1)-sqrt(I2))2

3 variables and 1 function are used in this formula.

Used Functions

Square root function and sqrt (Number)

used variables

The effect of two intensities coming together is called the "resulting intensity" (measured in candela).

The energy that the first wave transfers over a surface of a given area in a unit of time is measured as intensity 1 (measured in candela), which is equal to the energy density times the wave speed.

The energy that the second wave transfers over a surface of a certain area in a unit of time is measured as intensity 2 (measured in candela), which is equal to the energy density times the wave speed.

No conversion is necessary for intensity 1: 4 candela to 4 candela.

Intensity 2: No Conversion Needed 3 Candela to 3 Candela

Replacement of Input Values in a Formula

I is equal to (sqrt(I1)-sqrt(I2))2 --> (sqrt(4)-sqrt(3)).

2 Assessing...…

I = 0.0717967697244909

Candela: 0.0717967697244909 No Conversion Is Necessary

RESULT 0.0717967697244909 A candela Outcome Intensity (Calculation completed in 00.016 seconds)

What is Wave Interference?

When two waves that are moving in opposite directions arrive at the same location simultaneously, interference results. The two waves will combine into a temporary, larger wave with an amplitude equal to the sum of their individual amplitudes if their crests and troughs completely line up. Constructive interference is what this is. On the other hand, if the crests of two waves coincide, they either combine to form a smaller wave or completely cancel each other out. We refer to this as destructive interference.

Learn more about Hand here:

https://brainly.com/question/12762814

#SPJ4

If you need to stop quickly and your vehicle is not equipped with an Anti-Lock Braking System (ABS), you should:

Answers

It is important to note that vehicles without ABS may take longer to stop and have a greater risk of skidding or losing control, so it's important to be aware of the stopping distance and to drive with caution.

What is ABS?

Anti-Lock Braking System (ABS) is an advanced safety feature that is commonly found in modern vehicles. It is designed to prevent the wheels of a vehicle from locking up during braking, which can cause the vehicle to skid and lose control.

If you need to stop quickly and your vehicle is not equipped with an Anti-Lock Braking System (ABS), you should:

Press the brake pedal firmly and steady, do not pump the brakes.

Steer the vehicle in the direction you want to go.

Avoid locking up the wheels by applying the brake pressure smoothly and progressively.

If the wheels lock, release the brake pedal slightly to regain traction and then reapply the brake pressure.

Keep a safe distance from the vehicle in front of you to give yourself more time to react and stop.

Hence, by following the above mentioned steps you can quickly stop a car not equipped with ABS.

To learn more about ABS from the given link:

brainly.com/question/8555918

#SPJ4

Uma wants to recreate the discovery of superconductivity. Which describes the materials needed?

A) a tool to increase temperatures, copper, resistance, a tool to measure electric current
B) a tool to drop temperatures, mercury, an electric current, and a tool to measure resistance
C) a tool to drop temperatures, mercury, resistance, a tool to measure electric current
D) a tool to increase temperatures, copper, an electric current, and a tool to measure resistance

Answers

Answer:

B)a tool to drop temperatures, mercury, an electric current, and a tool to measure resistance

B a tool to drop temp

A paper airplane is thrown with an initial velocity of 2.4 m/s and an angle of 60°. Find the voy

Answers

Initial velocity of 2.4 m/s and an angle of 60°.

The x component is 2.4 m/s cos(60°) = 2.4 m/s (0.5) = 1.2 m/s

The y component is 2.4 m/s sin(60°) = 2.4 m/s (0.866) = 2.08 m/s

What is Initial velocity?

Initial velocity is the speed an object has when it starts moving in a certain direction. It is the speed that an object has before any external forces act upon it. Initial velocity is a vector quantity, meaning it has both a magnitude, or size, and a direction. Initial velocity is usually measured in meters per second (m/s). It is important to note that the initial velocity of an object can be different depending on the reference frame from which it is measured.

To learn more about Initial velocity visit:

brainly.com/question/28996913

#SPJ1

The complete question is-

A paper airplane is thrown with an initial vclocity of 2,4 m and angle of 60" Find the Voz: 012m/s 0.62 mn/& 0 1.70 m/8 208 m/$

A 2.6-mm-diameter sphere is charged to -4.4 nC. An electron fired directly at the sphere from far away comes to within 0.32 mm of the surface of the target before being reflected.
a. What was the electron's initial speed?
b. At what distance from the surface of the sphere is the electron's speed half of its initial value?
c. What is the acceleration of the electron at its turning point?

Answers

The correct answer to the given question is -6.944 * 10^-28 Joules

a. To find the electron's initial speed, we can use the conservation of energy. The initial kinetic energy of the electron must equal the final potential energy of the electron at its closest approach to the sphere.

Ki = 1/2 * me * v^2

v = sqrt(2Ki/me)

Ki = qe * V = (1.6 x 10^-19 C) * (-4.4 x 10^-9 C) = -6.944 x 10^-28 J

b. At the point where the speed of the electron is half of its initial value, the kinetic energy of the electron is half of its initial value. Therefore,

Ki/2 = 1/2 * me * (v/2)^2

we can solve for the distance from the surface of the sphere using the same equation as in part a, and substituting Ki/2 and v/2 for Ki and v respectively

c. The acceleration of the electron at its turning point can be found using the equation for centripetal acceleration:

a = v^2/r

where a is the acceleration, v is the speed of the electron, and r is the distance of the electron from the center of the sphere at its closest approach. We can use the value of v from part a and the distance from part b to find the acceleration.

Read more about Kinetic Energy from:

https://brainly.com/question/26472013

#SPJ4

Does rain occur most often in warm air masses, cold air masses or at warm fronts where two meet and interact?

Answers

Answer:

at warm fronts where two meet and interact

Explanation:

Warm fronts often bring stormy weather as the warm air mass at the surface rises above the cool air mass, making clouds and storms

ps. I'm not very sure if it's correct

2. Yvonne van Gennip of the Netherlands ice skated 10.0 km with an aver- age speed of 10.8 m/s. Suppose van Gennip erosses the finish line at her average speed and takes a huge bouquet of flowers handed to her by a fan. As a result, her speed drops to 10.01 m/s. If van Gennip's mass is 63.0 kg, what is the mass of the bouquet

Answers

The mass of the bouquet can be calculated using the equation m = F/a. Which is equal to 0.9kg.

Since van Gennip’s speed dropped from 10.8 m/s to 10.01 m/s after she took the bouquet, this indicates that a force was applied to her causing her to slow down.

The applied force can be determined by taking the difference between her final and initial momentum, which is p = mv.

Thus, the applied force can be calculated by F = Δp/Δt.

Plugging in the given values, the mass of the bouquet can be calculated as

m = F/a = (63.0 kg × (10.8 m/s - 10.01 m/s))/10.01 m/s² = 0.9 kg.

Therefore, the mass of the bouquet is 0.9 kg.

Learn more about mass:

https://brainly.com/question/28021242

#SPJ4

Find the equivalent resistance of this
circuit.
Ri
R2
1002 2202
R3
w
320 12

Answers

Answer:

Re=160ohm

Explanation:

Step#1

Rt=R1+R2 ( because both are in series)

Rt=(100+220 ) ohm

Rt=320 ohm

Step#2

Rt and R3 are parallel so,

Re= (Rt× R3) ÷ (Rt+R3)

Re= (320×320)÷( 320+320)

Re = 102,400÷ 640

Re=160ohm

the goal of condensed matter physics is to explain all the properties of matter by its electronic configuration

Answers

The study of the macroscopic characteristics of materials is known as condensed matter physics.

It attempts to predict the collective behaviours of extremely large quantities of electrons, atoms, or molecules using the well-established rules of microscopic physics.

More unusual condensed phases include the Bose-Einstein condensate found in ultracold atomic systems, the ferromagnetic and antiferromagnetic phases of spins on crystal lattices of atoms, and the superconducting phase displayed by some materials at low temperatures. Condensed matter physicists use experiments to measure different material properties and mathematical models developed by using the physical laws of quantum mechanics, electromagnetism, statistical mechanics, and other theories to understand how these phases behave.

To know more about condensed matter

https://brainly.com/question/7298907

#SPJ4

hello please help i’ll give brainliest

Answers

Answer:

B

Explanation:

They move at a rate of one to two inches (three to five centimeters) per year.

the air leaves the balloon in one direction; the car moves in the opposite direction. This balloon car illustrates for action, there is an equal and opposite reaction or?

Answers

Answer:

Newtons 3rd law

Explanation:

A crane does 900 Joules of work in 40 seconds. What amount of power did it have?

Answers

power = workdone/timetaken

=900/40

=22.5W

Answer:

900/40

22.5W

Explanation:

power =

Work done / time taken =

=900/40

=22.5W

Why is countercurrent flow better for dialysis?

Answers

The countercurrent flow is better for dialysis because-

The dialysate flows in the opposite direction from the blood. More urea and creatinine are removed from the blood as a result of the dialysate and blood flowing counter-currently, which optimizes the concentration gradient of solutes between the two fluids.

All throughout the dialyzer's length, countercurrent flow optimizes the concentration gradient between blood and dialysate Small solute clearance falls by 10% when blood flow and dialysate flow are cocurrent (moving in the same direction). Because they produce a more consistent temperature difference between the fluids along the whole length of the fluid channel, counter flow heat exchangers naturally outperform parallel flow heat exchangers in terms of efficiency.As an illustration, a faster blood flow rate boosts clearance by increasing the volume of blood evacuated each minute7. Additionally, a quicker dialysate flow rate results in more solutes being removed from the dialysate fluid, increasing the concentration gradient and the clearance rate8–10.

To know more about dialysis here

https://brainly.com/question/28063794

#SPJ4

7.) A 72 kg skier is beginning to ski down a slope starting 90 meters high. There is an issue, the skier did
not see a curb in the slope and did not realize they were going to hit a wall at the bottom of the slope. It
was observed by a nearby instrument that when the skier collided with the wall of snow there was 64 J
of sound energy given off. The rest of the kinetic energy was converted to heat energy, what was the
amount of kinetic energy converting to heat from the collision?

Answers

The total energy of the skier at the beginning of the slope is 63360 J.

What is total energy?

Total energy is the sum of all the energies of a system, including thermal, mechanical, electrical, and chemical. It is the measure of the capacity of a system to do work. It can be expressed as the product of the mass of the system and its velocity squared.

The kinetic energy of the skier at the beginning of the slope is given by the equation KE = .5mv^2, where m is the mass of the skier (in kilograms) and v is the velocity of the skier (in meters per second).

The kinetic energy at the beginning of the slope is (0.5)(72kg)(0m/s)^2 = 0 J. Since the skier was 90 meters high, we can assume a gravitational potential energy of (90m)(9.8m/s^2)(72kg) = 63360 J.

Therefore, the total energy of the skier at the beginning of the slope is 63360 J.

At the end of the slope, the skier converts the energy into sound and heat energy. The sound energy of 64 J is given. Therefore, the heat energy must be 63360 - 64 = 63296 J. This is the amount of energy converted to heat energy from the collision.

To learn more about total energy
https://brainly.com/question/8101588
#SPJ1

A classroom has a volume of

165 m^3. How many moles of gas

are in the room if the temperature

is 20. 0°C and the pressure is

1. 00 atm?

(Make sure to put P, V, and I

in the right units. )

(Unit = mol)

Answers

The number of moles in the room which has a volume of 165 m³ is 0.0686 moles

The volume of the classroom = 165 m³

The temperature of the room = 20°C

                                                 =  293 K

The pressure = 1 atm

The number of moles in the room can be found using the formula,

              PV = nRT

where P is the pressure

          V is the volume

          n is the number of moles

          R is the gas constant

          T is the temperature

Let us rearrange the above equation, we get

         n = PV/RT

Let us substitute the known values in the above equation, we get

        n = 1 x 165 / 8.21 x 293

           = 165 / 2405.53

           = 0.0686 moles

Therefore, the number of moles in the room is 0.0686 moles

Learn more about the moles in

https://brainly.com/question/26416088

#SPJ4

How are velocity and force similar?

Answers

Answer: Force

In physical science, a force is something that acts on an object by pushing or pulling it. If the force is strong enough, it changes the position or shape of the object. Forces such as friction, air resistance and simple physical contact touch the object directly, while forces like gravity, magnetism and electrostatics act on the object from a distance. Force is a vector quantity, meaning you can measure both its strength and its direction. The formula to find the measure of a force is force = mass times acceleration, written as f = ma.

Velocity

The faster something is moving, the higher its velocity.

When an object is moving, one way to measure how fast it is moving is by finding its velocity, which is the rate at which it is changing position. Like force, velocity is a vector quantity, so it includes direction. To find the average velocity of an object, divide the change in its position by the time the movement took, and state its direction. For example, if a car is driving north and in one hour's time it travels 30 miles, its velocity is 30 miles per hour, north.

\_:Peepato1234:_/

Which color will absorb the most heat, and why is that so?

Answers

Answer:

Dark colors absorb more radiated heat from the sunlight while lighter colors reflect it. That's why wearing a black shirt on a sunny day makes you feel so much hotter than when you're wearing a white shirt!

Answer:

black

Explanation:

Light energy can be converted into heat energy. A black object absorbs all wavelengths of light and converts them into heat, so the object gets warm

How does using myNav Accenture to help its client become more sustainable?

Answers

Accenture can assist its clients in being more sustainable thanks to the myNav. By making it easier to create cloud solutions that lower carbon emissions by rearranging manufacturing facilities such that carbon emissions can be calculated with ease.

by establishing new corporate efforts to lower transportation expenses and by establishing new rules for the disposal of out-of-date technology.

​reduces the expense of transportation

creates a design that is appropriate and aids the customer in becoming more sustainable.

establishes sustainable guidelines for disposing of outdated technology.

myNav Green Cloud Advisor assists businesses in developing cloud solutions that cut carbon emissions and create a platform for ethical innovation. Green Cloud Advisor starts by establishing a baseline for the energy usage, compute needs, and sustainability objectives of current data centers.

To learn more about myNav Accenture from given link

https://brainly.com/question/30090589

#SPJ4

9. Does the amount of work on the household object change if you lift the object faster? Why or why not? because​

Answers

Answer:

nvwngviuvnbowibnoijbdofij

Explanation:

. Two spherical objects have masses of 8,000 kg and 5.0 kg. Their centers are separated by a distance
of 1.5 m. Find the gravitational attraction between them.

Answers

Two spherical objects have masses of 8000 KG and 1500 KG their centers are separated by a distance of 1.5 M, the gravitational attraction between them is 3.56 × 10⁻⁴N.

How does gravitational force work?

The gravitational force, also known as gravity, pulls objects with mass in the same direction. We frequently think about the Earth's gravitational pull. This force is firmly holding your body in place. But every mass-bearing object attracts other mass-bearing objects toward it through gravity.

Using the formula of gravitational attraction

F = G× M₁M₂/d²

where G = 6.67 × 10⁻¹¹ Nm²Kg⁻²

M₁ = 8000Kg

M₂ = 1500 Kg

F =  6.67 × 10⁻¹¹ × 8000 × 1500 / (1.5)²

F = 3.56 × 10⁻⁴ N

The gravitational force of attraction between them is 3.56 × 10⁻⁴ N.

To know more about gravitational force visit:

https://brainly.com/question/19136576

#SPJ1

Describe a method that can be used to open a tight lid of bottle without damaging it

Answers

Answer:

But the safest way to loosen a tight cap may be to run hot water on it so that it expands slightly.

Explanation:

name an instrument that is used to produce high pitched notes

Answers

Answer:

The smaller instruments, the violin and viola, make higher-pitched sounds, while the larger cello and double bass produce low rich sounds

[tex]hey \: i \: am \: new \: here \: nice \: to \: meet \: you[/tex]

Answer:

base ,violin,cello are some

Other Questions
i need help im almost done and this is my second to last question probably helpppp please help !!!!!!!! conjugate these three words in the future tense: I will be awarding brainliest for anybody who gets it right, 3 new titles for Insurgent and a paragraph describing why The wind force f on a sail varies jointly as the area a of the sail and the square of the wind speed w. The force on a sail with an area of 500 ft^2 is 64. 8 pounds when the wind speed is 18 mph. What would be the force for a sail with an area of 250 ft^2 with a wind speed of 35 mph Are Tropical rain forests are typically located close to the equator? plane flew from Red Deer to Winnipeg, a flying distance of 1260 km. On the return journey, due to a strong head wind, the plane travelled 1200 km in the same time it took to complete the outward journey. On the outward journey, the plane was able to maintain an average speed 20 km/hr greater than on the return journey. Calculate the average speed of the plane from Winnipeg to Red Deer. To pay for a $15,900 car, Donna made a down payment of $4800 and took out a loan for the rest. On the loan, she paid monthly payments of $245.70 for 4years.(a) What was the total amount Donna ended up paying for the car (includingthe down payment and monthly payments)?(b) How much interest did Donna pay on the loan? Is this correct? I can't figure out if this is, So please answer. streamlined transportation vehicle with 2 openings and glass windows. It appears to run on some kind of track.Predict what the text will be about based on this image?a.future transportationc.both of theseb.public transportationd.neither of these Sam has always been able to pick up new languages easily. What quality does she have that helps her do this?soft skills.self-awarenesscompetencyability What baseball stat does Lawrence Hinman suggest is the most important stat for determining the best player in the game in a given year Where should the comma go in the following sentence **You should not need to round on this problem, no %'s decimals only**At Houston Community College 60% of the students who take English will pass. Of those who pass English, 70% will also pass Accounting. Of those that do not pass English, 45% will still pass accounting. How do you find the 3rd side of a triangle? Select the correct answer. Which graph represents the solutions to this equation? x2 + 8x = -20 A. Linear-quadratic system graph shows upward parabola with vertex at (minus 2, 4) and passing through x and y-axis (minus 8, 0), and (0, 0) B. Linear-quadratic system graph shows upward parabola with vertex at (minus 4, 4) and passing through (minus 2, 8), and (minus 6, 8) C. Linear-quadratic system graph shows upward parabola with vertex at (4, 0) and passing through (1, 4), and (6, 4) D. Linear-quadratic system graph shows a downward parabola with vertex at (0, 8) which intercepts the x-axis at 3 and minus 3 units. Lila swam 50 meters north in 10 seconds. Find Lila's velocity TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets. True/False: Money is more important than finding something you're going to lovedoing. Select the correct answer.Which of these is an example of elemental carbon?A. DiamondB. MethaneC. Proteins 6 less than 3 times a number 42 what is the number