How do you teach the rotation and revolution of the Earth?

Answers

Answer 1

When talking about the orbits of the Sun, Earth, and Moon, students often get tripped up by the difference between rotation and revolution. In order to gain a full comprehension of the significance of these social shifts, it is essential to be familiar with the distinctions between these terms. I've compiled a list of the most useful resources I've found for educating pupils about revolution and rotation.

Rotation

Numerous items exist in the real world that can serve as models for rotary motion. You could use a coin or a toy top instead, but we recommend a fidget spinner given their current popularity. Distribute fidget spinners and give each team or person a minute or two to fiddle with one.

Questions to stimulate conversation amongst peers:

In what way do you perceive motion?

Are you able to pinpoint where the action is actually taking place?

Revolution

Since we now have children, we frequently use their playthings as props in our lectures. One of our favorite ways to pretend play at a revolution is by using a set of wooden, interlocking train tracks and a toy train to circle a toy structure in the middle.

To know more about the concepts:

https://brainly.com/question/11691986

#SPJ4


Related Questions

true or false a scope of practice may or may not state the services cosmectologist cannot legally perform

Answers

A scope of practice may or may not state the services cosmectologist cannot legally perform. It is a true statement.

A cosmetologist gives facial and body clients pleasant and calming skin treatments. They offer a variety of skin care procedures as well as services to enhance one's appearance, including applying makeup, getting facial and scalp treatments, styling hair, and getting manicures and pedicures.

You can enjoy your career as a cosmetologist. rewarding: Working in the cosmetology sector may give professionals the chance to engage with a diverse range of people. With their clients and coworkers, many cosmetologists form enduring interpersonal relationships. Inspiring: Cosmetology is a vocational skill and an art.

To know more about cosmectologist: https://brainly.com/question/25950697

#SPJ4

Which of the following BEST describes agriculture in Texas after the Civil War?

a. It began depending on sharecropping.

b. It was destroyed when slaves were freed.

c. It increased cotton production.

d. Even the poorest could afford to buy land.

Answers

Answer:

i think its A

Explanation:

The agriculture in Texas after the Civil War is best described as It began depending on sharecropping. Thus the correct option is A.

What is agriculture?

Agriculture refers to the practice of farming or cattle rearing by managing livestock. This includes crop production while maintaining the quality of soil with the help of proper fertilsers to improve production.

Texas' economic system was devastated by the Civil War. To support themselves and their families, many Texans went back to agriculture. Sharecropping was its foundation at first.

The sharecropping farming system was developed to help poor farmers of all ethnicities survive financially and physically as well as to satisfy the labor needs of white landowners.

Therefore, option A is appropriate.

Learn more about Agriculture, here:

https://brainly.com/question/3632132

#SPJ2

What did 9 of the 13 states have to do for the Constitution to be approved?

Answers

For the Constitution to be recognized, nine states had to vote in favor of it. Each state has six months to hold a meeting and vote on the proposed Constitution.

Delaware was the first state to vote in favor of it, or ratify it, on December 7, 1787. The Constitution would go into force if nine of the thirteen state legislatures ratified it; unanimity was not required. During the constitutional debate, two factions emerged: the Federalists, who backed adoption, and the Anti-Federalists, who opposed it.

In June, New Hampshire became the ninth state to accept the Constitution, but the critical states of Virginia and New York were embroiled in contentious arguments.

On June 21, 1788, New Hampshire ratified the Constitution, becoming the ninth state to do so. The Constitution became the formal law of the United States, and the colonies were transformed into states. Virginia and New York quickly followed.

Learn more about to Constitution

https://brainly.com/question/29799909

#SPJ4

Quienes apoyan a los adolescentes

Answers

Answer:

yo

Explanation:

Freud proposed that all children experience a(n) __________ in which they desire to displace their __________ parent and enjoy sexual access to the __________ parent.

Answers

The Oedipus complex was defined by Freud as a child's sentiments of yearning for their opposite-sex parent and hatred toward their same-sex parent.

The Oedipal complex is a term coined by Sigmund Freud in his theory of psychosexual stages of development, and it refers to both the Oedipus and the Electra complexes. The Oedipal complex develops during the Phallic stage of development (ages 3-6), when the source of libido (life force) is concentrated in the child's erogenous zones (Freud, 1905).During this period, youngsters have an unconscious longing for their opposite-sex parent and feelings of jealously and envy toward their same-sex parent. When the youngster learns to connect with his father as an indirect means to have the mother, the Oedipus complex is effectively addressed.

To know more about The Oedipus complex:

https://brainly.com/question/9429811

#SPJ4

What was Korematsu's argument?

Answers

Korematsu used to be arrested and convicted of violating the order. He responded by way of arguing that Executive Order 9066 violated the Fifth Amendment of the Constitution

because habeas corpus had no longer been suspended, and his right to libery used to be being infringed with the aid of army action without due method of law.

What was Korematsu struggle for?

the civil rights of all Americans

Fred Korematsu continued to battle for the civil rights of all Americans. He lobbied in Congress to omit the Civil Liberties Act of 1988. This act gave a public apology and compensation to Japanese Americans who had been incarcerated. In 1998, Korematsu used to be awarded the Presidential Medal of Freedom.15-Sept-2021

Learn more about Korematsu  here:

https://brainly.com/question/3552660#SPJ4

Mrs. Garcia decided to reward her students/class with a party or a special treat at the end of the week for good behavior throughout the week. What theory is Mrs. Garcia using

Answers

Mrs. Garcia decided to reward her students/class with a party or a special treat at the end of the week for good behavior throughout the week. Mrs. Garcia is using Theory of Behaviorism.

The Theory of Behaviorism, which describes how people interact with their surroundings, holds that everyone picks up social skills from their surroundings. This learning theory contends that because an individual's hereditary qualities tend to result in many common and similar behaviours, environmental factors have a considerably bigger influence on behaviour than innate or inherited traits. It makes the claim that an organism's actions follow from its inputs. It mostly focuses on behaviour that is obvious from a distance. The internal workings of the mind are not considered. It alludes to the development of novel behaviours.

To learn more on  Theory of Behaviorism, visit:

https://brainly.com/question/25355455

#SPJ4

Which of the following should NOT be done by consumers?

Reading the contract before borrowing money.

Planning and making informed decisions about purchases.

Buying the first product available because of limited availability.

Understanding the warranty of any product.

Answers

A task which should not be performed by consumers is: C. buying the first product available because of limited availability.

Who is a consumer?

A consumer can be defined as an individual who purchases products (goods) or services from a seller, especially for his or her own (personal) use rather than being used for entrepreneurial or business activities.

In Economics, some of the duties of a consumer include the following:

Reading the contract paper before borrowing money.A consumer should plan and make informed decisions about purchases.A consumer should understand the warranty of any product.

However, it is the duty of a seller or service provider to buy the first product available because of limited availability.

Read more on consumers here: https://brainly.com/question/1213062

Answer:

Buying the first product available because of limited availability.

Explanation:

The prophets before the exile would focus on ___, while those during the exile would focus on ___, and those after the exile would be concerned with __.

Answers

The prophets before the exile would focus on judgement, while those during the exile would focus on hope, and those after the exile would be concerned with moral transformation.

Prophets of exile are individuals who are believed to have a special connection to the divine and are able to interpret the will of the gods. They are often seen as wise and powerful figures who can provide guidance and insight to those in need.

They are also seen as messengers of the gods, delivering messages of warning or hope to those in need. Prophets of exile are often seen as spiritual guides, providing comfort and guidance in times of hardship or despair.

To know more about exile, click here.

https://brainly.com/question/19933131

#SPJ4

Trade barriers discourage consumers from buying imported goods because barriers can __________. A. make imports much more common B. increase the volume of trade C. lower the taxes placed on imports D. increase the price of imports

Answers

Answer:

Option D: Increase the price of imports

Explanation:

Trade Barrier

This is defined as a restriction or anything that slows down or prevents one country from exchanging goods with another. They are enacted by government of a country. They includes: Tariff, quota and embargo

Tariff

This is simply defined as a form of tax that is placed on goods imported from abroad into a particular country. The purpose of a Tariff is to raise the price of the imported product.

Benefits of trade barriers

1. Protect domestic industries from competition.

2. Protect jobs and help provide extra income for the government.

3. Increases the Number of goods people can choose from and decreases the costs of these goods through increased competition.

Costs of trade barriers

1. Tariffs increase the price of imported goods and there is little competition from world markets means there is an increase in prices.

2. The tax on imported goods is passed along to the consumer so the price of imported goods is higher.

Answer:

D

Explanation:

Trina believes in the approach to psychology known as Gestalt psychology. How is this BEST demonstrated

Answers

Trina believes in the approach to psychology known Gestalt psychology. This was best demonstrated by believing that there is more to perception than meets the eye according to Gestalt psychologists.

The Gestalt psychology approached for the thoughts of school children that looks at the human behavior and mind as a whole.Instead of that our minds tend to perceive objects as elements of more complex systems.

Gestalt psychology accepted the study of consciousness and truely demonstrated that humans first perceived an object as a whole before viewing its individual parts but criticized the attempt to analyze it into elements.

Learn more about Gestalt psychology click on the link here:

https://brainly.com/question/28941198

#SPJ4

Research and compare the following three psychological theories—Piaget’s theory of cognitive development, Erikson’s theory of psychosocial development, and Kohlberg’s theory of moral development. Present your answer in a comparative table and include at least six points of comparison. You can add more rows to the table, as needed.


Complete the table:


Piaget’s Theory of Cognitive Development Erikson’s Theory of Psychosocial Development Kohlberg’s Theory of

Moral Development

Answers

Erikson says that our concept of self is said to be shaped by our social interactions and our ability to perform the social duties. A theory of cognitive development by Jean Piaget describes how kids reason and think while progressing through different stages.

The famous theorists who are said to have made significant contributions to the nursing profession tend to include Lawrence Kohlberg and Erik Erikson. Whereas, the Erikson's theory discusses psychological development.

However, the Kohlberg's theory tend to focus on moral growth. Erikson, like Piaget, was stressed that children's development happens via interaction. While Jean Piaget gave the theory of the cognitive development.

Hence, they are said to highlight that thr development happens in phases.

To learn more about the cognitive development here:

https://brainly.com/question/26425192

#SPJ4

In which decision did the Supreme Court rule that American foreign policy is vested entirely in the federal government where the president has plenary power

Answers

In Curtiss-Wright Export Corp. v. United States the Supreme Court rule that American foreign policy is vested entirely in the federal government where the president has plenary power.

The United States Supreme Court ruled on the President of the United States' authority over foreign affairs in United States v. Curtiss-Wright Export Corp., 299 U.S. 304 (1936). It was argued that the President had substantial powers over foreign affairs that considerably outweighed any that were allowed in domestic issues or given to the U.S. Congress since he served as the country's "sole organ" in international relations. The majority of the court reasoned that although while such authority is not expressly granted by the U.S. Constitution, it is implied by the President's position as commander-in-chief and head of the executive branch. The first ruling to establish that the President's plenary power is apart from congressional approval was Curtiss-Wright. It is acknowledged for setting the legal precedence.

Learn more about constitution here:

https://brainly.com/question/29799909

#SPJ4

Think about the color white and what Americans associate it with. What does white traditionally symbolize in the United States

Answers

White traditionally symbolize in the United States is Innocence, cleanliness, purity.

According to color psychology, colors can signify various things. White, however, is frequently linked to innocence, cleanliness, and purity in western society, and it has even been dubbed the hue of perfection. White is a hue that has religious significance in many different civilizations. White denotes innocence or purity. White can add highlights or a sense of spaciousness because it is bright. According to color psychology, white has the following qualities: White denotes innocence or purity. White can add highlights or a sense of spaciousness because it is bright. White is also thought to be icy, tasteless, and sterile. 

To learn more about traditionally symbolize please click on below link

https://brainly.com/question/18647771

#SPJ4

What were the 5 largest cities in the colonies?

Answers

The 5 largest cities in the colonies: Philadelphia, New York, Boston, Newport and Charleston

A colony is an area that is entirely or partially governed politically by another country, typically a remote one, and that is populated by immigrants from that country.

Megacities are metropolitan areas with a combined population of greater than 10 million. The term "megacity" often refers to an urban agglomeration's population, which includes residents of the adjacent suburbs outside of the defined city boundaries.

Many people relocated to cities in search of employment during the industrial revolution, which is when large cities first began to flourish historically. Typically connected to developed countries, this trend

The UN estimates that there will be more megacities in the future than the current 28.

For such more question on cities:

brainly.com/question/17518167

#SPJ4

who was the first to assess people's intellectual strengths, and in what year and where did this person administer 10,000 of his tests

Answers

The  first to assess people's intellectual strengths, in 1904, by Alfred Binet (1857-1911). He was one of the most influential psychologists in history.

In the face of moral, financial, psychological, or interpersonal adversity, courage or fortitude persuasive argument Willpower, physical stamina, mental fortitude, and knowledge and expertise in these things are all necessary. Intellectual strengths is the ability of a person to pick up new skills from their surroundings and put them to use. having the mental capacity to execute intricate math calculationsThe immense power that people feel when they are facing impending death is known as hysterical strength.

Learn more about intellectual strengths:

https://brainly.com/question/14620049

#SPJ4

What are the three social contract theory?

Answers

Answer:

The three social contract theories are laws, judges to adjudicate laws, and the executive power necessary to enforce these laws.

Explanation:

Hope it helps:)

What country was Bernardo de Gálvez from?

A. France

B. Spain

C. Britain

Answers

Hes from Macharaviaya, Spain
So (B. Spain)

Answer:

Spain, Louisiana

Explanation:

EDGE2021

Write any six reasons to protect human rights by the state

Answers

Answer:

1, Human rights ensure people have basic needs met.

2. Human rights protect vulnerable groups from abuse

3.Human rights allow people to stand up to societal corruption

4. Human rights encourage freedom of speech and expression

5.Human rights allow any practiced religions

6.Human rights open chances to education

Explanation:

Yw :)

Hope i helped, if it’s wrong reach out to me and tell me.

have a great day.

how are the ecoregions of texas determined

Answers

Answer:

As in the rest of the Great Plains, fire, topography, and drought maintained prairie and established the location of woodlands

Yeo I just did this for some one but I forgot it dang

what are the factors influence the distribution pattern of railways in india? class 10 Geography chapter 7​

Answers

Answer:

The distribution pattern of the Railway network in the country has been largely influenced by physiographic, economic and administrative factors. The northern plains with their vast level land, high population density and rich agricultural resources provided the most favourable condition for their growth.

Explanation:

What is Enlightenment according to Kant What does he mean by the phrase dare to know?

Answers

Immanuel Kant believed that enlightenment is the capacity of a person to reason, to analyze, and to comprehend events without the aid of another person.

What is enlightenment?

Francis Bacon, John Locke, and other intellectuals' contributions to the Scientific Revolution before the Enlightenment. René Descartes' 1637 publication of his Discourse on Method, which included the well-known line "Cogito, ergo sum," is frequently credited with sparking the Enlightenment. The fundamental tenets of the Enlightenment were individual liberty and religious tolerance as opposed to an absolute monarchy and the unchangeable doctrines of the Church. The ideas of utility and sociability also played a key influence in the dissemination of information for the benefit of society at large. An increasing awareness of the relationship between the intellect and popular media of the time helped define the Enlightenment.

To learn about enlightenment, visit:

https://brainly.com/question/20606481

#SPJ4

What did the Declaration of Independence say the king violated?

Answers

He has attempted to prevent the population of these States by obstructing the Laws for the Naturalization of Foreigners;

refusing to pass others to encourage their migrations here; and raising the conditions of new Appropriations of Lands.

The most important and dramatic statement comes near the end: "That these United Colonies are, and of Right ought to be, Free and Independent States." It declares a complete break with Britain and its King, claiming the powers of an independent country.

They claim that the king has ignored or altered their colonial governments, as well as their right to a jury trial. The colonists accuse King George III of sending a hired army to force them to obey unjust laws. They claim the king is "unfit to rule a free people."

Learn more about "  Declaration of Independence " to visit here;

https://brainly.com/question/3000142

#SPJ4

Many sociologists study innovation. Why would this MOST likely enhance their research?
A.) Sociologists can use new items like a computer to type research papers.
B.) New products and ideas play a big role in the evolution of culture.
C.) Culture rarely changes when innovation occurs.
D. Sociologists believe that innovation will die off very soon.

Answers

the correct answer is b

a researcher is interested in assessing risk-taking by individuas. The reseracher is sitting on a bench near a busy four-way stop intersection. She plans on recording the number of bike riders wearing a safety helmet and wehther they stop at the itnersection before proceeding in order to correlate use of safety appparel with risk-taking. This collection ofinformation is an example of

Answers

The method of research which aims at correlating safety measures with risk taking capacity of individuals is called as public behavior.

The collection of information is very important while researching because it provides the real time analysis of all the correlations and comparison which are going to be conducted in the research. The public behavior is guided by the conditions that prevail in public location such as street, market or building. The tendency of the person to wear helmet to keep them safe and their tendency to wait at the cross roads before taking any turn is based on the educational pattern they have undergone and the civic cognition which they got from the public driving in general. There can be numerous anomalies in such research. However, a close study of the behavioral pattern can help to provide effective research outcome.

Learn more about public behavior at:

brainly.com/question/24518056

#SPJ4

Which of the following is NOT one of the main ways to reduce cognitive dissonance?
Multiple Choice
O Change your attitude.
O Complete an emotional intelligence assessment.
O Change your behavior.
O Find consonant elements that outweigh the dissonant ones.
O Belittle the importance of the inconsistent behavior.

Answers

Complete an emotional intelligence assessment  is not one of the main ways to reduce cognitive dissonance.

How does cognitive dissonance affect behavior?

When people find themselves acting or holding beliefs that contradict their self-image or other beliefs they hold, they frequently experience cognitive dissonance, an uncomfortable mental state. American social psychologist Leon Festinger established it for the first time back in 1957. When someone truly believes one thing but thinks or behaves in a way that is inconsistent with that conviction, cognitive dissonance, an uncomfortable mental state, may ensue.

The desire to lessen cognitive dissonance is a result of cognitive dissonance. Many typical human tendencies, including justification and rationalization, as well as why our ideas change over time, are explained by this. Furthermore, failing to address the discrepancy might harm your mental health and general well-being.

To learn more about cognitive dissonance, visit:

https://brainly.com/question/11732168

#SPJ4

You're representing Missouri clients Abe and Ben in a dual agency situation. Abe tells you something that would give Ben a distinct advantage if he knew. Do you tell Ben

Answers

No you cannot tell Ben, because you can't share one client's confidential information with another client.

A lawyer's disclosure of information regarding the client's representation during the course of the lawyer's representation of the client is governed by the Confidentiality of Information Act. A key tenet of the client-lawyer relationship is that the lawyer may not disclose confidential information about the representation without the client's informed consent.

Thus, the client is advised to seek legal counsel and to be open and honest with their attorney, even when discussing sensitive or legally risky topics. This information is required for the attorney to successfully defend the client and, if necessary, to counsel the client to abstain from wrongdoing.

know more about confidential information here

https://brainly.com/question/29105134

#SPJ4

What is the difference between a federal and confederal system of government?

Answers

A sovereign state having autonomy in its governance and administration is known as a "federation."  As a result, under the Federation rule, states establish a central administration to represent them in topics that affect all states equally, such as international representation.

Confederation and federation are similar, however confederation is different in that confederation entities are sovereign and are formed through coalitions, whereas in federation this is done through a constitution. Therefore, a confederation is a union of states brought about through agreements between them. A confederation and a federation differ significantly in that a confederation maintains its constituent states' rights while a federation transfers such rights to the federal state.

The primary government of the United States is the federal government. Each state may be controlled by a state government, but it must abide by federal laws. Cities, municipalities, and counties are governed locally, yet they are subject to state legislation.

Power is spread evenly across the components of the confederate system, such as the states. Each component runs on its own. Together, the units will endeavor to meet their own needs. There is hardly any centralized power.

To know more about sovereign state,

https://brainly.com/question/10867010

#SPJ4

A person who is in between jobs but actively engaged in a job search is considered to be a. frictionally unemployed b. structurally unemployed c. cyclically unemployed

Answers

A person who is in between jobs but actively engaged in a job search is considered to be frictionally unemployed. Hence, option (a) can be considered to be the correct option.

Give a brief account on frictional unemployment.

When there are changes in voluntary employment within an economy, there is frictional unemployment. A brief term of unemployment is formed as people decide to switch jobs and as new workers join the workforce. In a growing, stable economy, frictional unemployment is acknowledged as a component of natural unemployment, the minimal unemployment rate brought on by market forces and labor migration. The number of people actively looking for work divided by the total labor force is the frictional unemployment rate. Three groups are commonly used to categorize the workers who are actively seeking employment: those who have recently left their occupations, those who are reentering the workforce, and newcomers.

To know more about, unemployment, visit :

https://brainly.com/question/13192140

#SPJ4

A depth cue that suggests depth in a frame by showing objects that are farther away as smaller than foreground objects is known as

Answers

Answer: Size diminution is called a cue that indicates the depth of the image by making distant objects appear smaller than foreground ones.
Other Questions
Are Tropical rain forests are typically located close to the equator? plane flew from Red Deer to Winnipeg, a flying distance of 1260 km. On the return journey, due to a strong head wind, the plane travelled 1200 km in the same time it took to complete the outward journey. On the outward journey, the plane was able to maintain an average speed 20 km/hr greater than on the return journey. Calculate the average speed of the plane from Winnipeg to Red Deer. To pay for a $15,900 car, Donna made a down payment of $4800 and took out a loan for the rest. On the loan, she paid monthly payments of $245.70 for 4years.(a) What was the total amount Donna ended up paying for the car (includingthe down payment and monthly payments)?(b) How much interest did Donna pay on the loan? Is this correct? I can't figure out if this is, So please answer. streamlined transportation vehicle with 2 openings and glass windows. It appears to run on some kind of track.Predict what the text will be about based on this image?a.future transportationc.both of theseb.public transportationd.neither of these Sam has always been able to pick up new languages easily. What quality does she have that helps her do this?soft skills.self-awarenesscompetencyability What baseball stat does Lawrence Hinman suggest is the most important stat for determining the best player in the game in a given year Where should the comma go in the following sentence **You should not need to round on this problem, no %'s decimals only**At Houston Community College 60% of the students who take English will pass. Of those who pass English, 70% will also pass Accounting. Of those that do not pass English, 45% will still pass accounting. How do you find the 3rd side of a triangle? Select the correct answer. Which graph represents the solutions to this equation? x2 + 8x = -20 A. Linear-quadratic system graph shows upward parabola with vertex at (minus 2, 4) and passing through x and y-axis (minus 8, 0), and (0, 0) B. Linear-quadratic system graph shows upward parabola with vertex at (minus 4, 4) and passing through (minus 2, 8), and (minus 6, 8) C. Linear-quadratic system graph shows upward parabola with vertex at (4, 0) and passing through (1, 4), and (6, 4) D. Linear-quadratic system graph shows a downward parabola with vertex at (0, 8) which intercepts the x-axis at 3 and minus 3 units. Lila swam 50 meters north in 10 seconds. Find Lila's velocity TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets. True/False: Money is more important than finding something you're going to lovedoing. Select the correct answer.Which of these is an example of elemental carbon?A. DiamondB. MethaneC. Proteins 6 less than 3 times a number 42 what is the number Two numbers total 31 and have a difference of 9. Find the two numbers. Can someone help me with this question? Can someone please help me with math. The process by which keys are managed by a third party, such as a trusted CA, is known as?O Key escrowO Key destructionO Key renewalO Key management