Explain briefly what is the branch of biologuy and the role

Answers

Answer 1

Answer:

Biology is a branch of science that deals with living organisms and their vital processes.

Explanation:

hope this helps


Related Questions


Which of the following describes the Koppen-Geiger climate Cfa?

Answers

humid subtropical

odyssey-ware. plant systems. i hate this class. good luck

Plz help me well mark brainliest if correct!!..

Answers

Answer: A: Valuable materials found in or on the Earth!

Scraping the inside of her cheek with a toothpick, a student was able to collect and view several identical cells on a microscope slide. This suggests the inside of her cheek shows which level of organization?

Select one:

Tissue.

Organ.

Organism.

Organ system.

Answers

Answer:

tissue because its the smallest one and could probably be more accurate

Which materials are exchanged between the ocean and the atmosphere? Select all that apply.
fish
plankton
energy
heat
water

Answers

Answer:

Water and energy

Explanation:

Water and carbon dioxide are exchanged between the ocean and the atmosphere. Carbon dioxide is taken out of the atmosphere by photosynthesis into plants to produce ENERGY.

HELPPPPP!!!!
Which of the following is a correct statement about designing an experiment?
All experiments require expensive laboratory equipment.
Data from one trial is enough to draw a conclusion.

Experiments can be designed and performed by anyone with a curious mind.

Variables do not affect the outcome of an experiment

Answers

Answer:

experiments can be designed and performed by anyone with a curious mind

Explanation:

baking soda and vinegar explosions are an experiment that doesnt require expensive equipment

always do more then one trial, like shooting a basketball, if you shoot once and miss, can you say that you will never make it? or if you make it, can you say that you will never miss?

variables are what you are testing, you have to eliminate as many as possible so they dont effect your experiment

if you have any questions, leave them in the coments and i will try to answer them, if this helped, pls give brainliest.

10. (04.03 HC)
Which substances are needed for cellular respiration?
Use complete sentences to explain how the mass of hydrogen is conserved during cellular respiration. (10 points)

Answers

Chemical reactions that simulate cellular respiration follow the Law of Conservation of Matter when they are balanced. Six carbon atoms, 12 hydrogen atoms, and 18 oxygen atoms are the same number of atoms as the reactants.   C₆H₁₂0₆+60₂ — 6C0₂+6H₂0 .

What is cellular respiration?

Through the process of cellular respiration, organisms mix oxygen with food molecules, directing the chemical energy contained in these substances toward life-sustaining processes while excreting carbon dioxide and water as waste. Foods are broken down by organisms that do not require oxygen in a process known as fermentation.

What are atoms?

A chemical element is uniquely defined by its atoms, which are small units of a substance. An atom is made up of a core nucleus and one or more negatively charged electrons that orbit it. The positively charged, comparatively hefty protons and neutrons that make up the nucleus may be present. The fundamental building components of matter are atoms. Atoms make up anything that has mass and occupies space.

To know more about cellular respiration, check out:

https://brainly.com/question/14158795

#SPJ1

9 ¿Cuál es la similitud entre una marea muerta y una marea de primavera?

Answers

Answer (in English):

Both Spring and Neap tides occur twice each month. Spring tides occur twice each lunar month all year not regarding what season it is. Neap tides, which also occur twice a month, occur when the sun and moon are at right angles of  each other.

En Espanol:

Tanto las mareas vivas como las mareas muertas ocurren dos veces al mes. Las mareas de primavera ocurren dos veces cada mes lunar durante todo el año sin importar en qué estación se encuentre. Las mareas muertas, que también ocurren dos veces al mes, ocurren cuando el sol y la luna están en ángulos rectos entre sí.

Compare and contrast the skin and GI tract microbiome?

Answers

In contrast to the stratified squamous epithelium of the skin, the intestinal barrier is composed of a single layer of columnar epithelial cells However, this single layer of intestinal epithelial cells is made of diverse cell types with absorptive, secretory, and immune function

why does wildlife conservation necessary why​why does wildlife conservation necessary why

Answers

Answer:

Conservation of Wildlife is important to protect the endangered plants and animal species along with their natural habitat. The main concern is to preserve the habitats so that the future generations of wildlife and even humans can enjoy it.

Answer:

it is necessary because nowadays many animals are being extincted, in order to stop this wildlife conservations have been established

What are the three parts to a feedback loop?

Answers

sensor -> control -> effector
Sensor,control,effector

Which of the following statements is TRUE?
OA.
Oogenesis is the production of ova
OB.
Oogenesis occurs once a month
O a.
Oogenesis is when a mature follicle bursts and releases a mature ovum.
OD.
All of the above

Answers

A. Oogenesis is the production of ova

1. A structure that forms in plant cells that forms during telophase/cytokinesis

2. Come from centrioles and are used to move chromosomes in animals cells

A. Cell plate
B. Centrioles
C. Spindle fibers

Answers

The cell plate forms in plant cells after telophase to separate the cells. Spindle fibers are used to help move the chromosomes in animal cells

The manager of a book store surveys people who buy mystery novels to see if the store should expand its hours. What is the population?​

Answers

Answer:

The population is people who buy mystery novels at that specific book store.

In the book store survey, the manager is trying to find the people who buys the mystery novels to see if the store should expand its hours. In this study, the population denotes the number of people who visits the book store. Thus, the correct option is C.

What is Population?

The population can be defined as the discrete assemblage of the entities with identifiable characteristics. A population can be the group of people, animals with the objective of analysis and data collection. A population consists of a similar group of species who lives in a particular geographical location with the capacity to interbreed.

In this situation, the population denotes the group of people who visits the book store on a daily basis and buys the mystery novels to read.

Therefore, the correct option is C.

Learn more about Population here:

https://brainly.com/question/27991860

#SPJ2

Your question is incomplete, most probably the complete question is:

The manager of a book store surveys people who buy mystery novels to see if the store should expand its hours. What is the population?​

a. People who like to read

b. Resident of the town

c. People who visit the book store

d. People who buy mystery books

ASAP HELP!!!!!!! LIMITED TIME!!!!!!! PLEASE
Hydrogen fuel cells, biodiesel, and long-term electric batteries are potential solutions to

Select one:

1. carbon sequestration

2. replacing coal as a major fuel for generating electricity

3. cap-and-trade emission control

4. reducing carbon emissions from cars and trucks

Answers

Answer:

reducing carbon emissions from cars and trucks

According to Gordon all port which type of personality traits are the most dominant

Answers

According to Gordon Allport, the type of personality trait that is the most dominant is the central trait or the basic trait.

What is trait?

This refers to a distinctive quality or character of a person. For example curiosity, fair, and dark. etc.

Gordon Allport is a psychologist and personality theorist. He divided personality traits into three categories: cardinal, central, and secondary. According to Allport, the most dominant type of personality trait is the central trait, also called as the "basic trait."

These traits are fundamental to a person's character and shape their overall personalities, such as honesty, kindness, and intelligence. Cardinal traits, on the other hand, are rare and extremely influential traits that shape a person's entire life and behavior, such as religious devotion or political ideology. Secondary traits are less important and more specific, such as being punctual or having a sense of humor.

Learn more about personality traits on

https://brainly.com/question/29497427

#SPJ1

2. Coastlines are continually eroded by what
process? sc.6.E.6.2
A longshore currents
B parallel shore currents
C shortshore currents
D perpendicular shore currents

???????????

Answers

Coastlines are continually eroded by longshore currents, which are currents that flow parallel to the shoreline. These currents can be caused by the wind and waves, and they can transport sediment (such as sand and gravel) along the coast. As the sediment is moved and deposited, it can cause the coastline to change shape and erode over time.

Answer:

Explanation:

Coastlines are continually eroded by longshore currents.

Longshore currents are ocean currents that flow parallel to the shoreline. They are created when waves approach the shore at an angle, and the water is deflected by the friction of the bottom and the shape of the coastline. The resulting current flows parallel to the shore, and can cause erosion of the coastline over time.

Parallel shore currents and shortshore currents are not correct terms. Perpendicular shore currents are not a natural phenomenon and do not occur in the real world.

True or False: Cells grow larger and that is why organisms grow larger.

Answers

Answer:

When organisms grow, it isn't because cells are getting larger. Organisms grow because cells are dividing to produce more cells.

Explanation:

pretty sure the answer is false

Describe these astronomical bodies that exist in our universe:
o Galaxy:
o Solar system:
o Star:
o Sun:
o Planet:
o Moon:
o Comet:

Answers

Answer:

:

A galaxy is a huge collection of gas, dust, and billions of stars and their solar systems, all held together by gravity

:The Solar System is the gravitationally bound system of the Sun and the objects that orbit it, either directly or indirectly.

:

A star is a luminous ball of gas, mostly hydrogen and helium, held together by its own gravity.

: The Sun is a sphere, composed almost entirely of the elements hydrogen and helium.

: A planet is a large celestial body that revolves around the sun in fixed orbits. Planets do not have any light of their own but reflect the light of the sun.

: The Moon is Earth's only natural satellite, a body that moves around a larger body in space.

: Comets are cosmic snowballs of frozen gases, rock and dust that orbit the Sun. When frozen, they are the size of a small town.

4. Carla placed three identical plants on a
sunny windowsill. Using the same amount
of water each time, she watered one plant
twice a day. She watered the second plant
once a week. She did not water the third
plant. After three weeks, she found that the
plant watered once a week was thriving.
The plant that was watered twice a day
was dying. The plant that was not watered
was brown and dead. What conclusion can
Carla draw?

A. Water causes plants to die
B. Plants need a certain amount of water to live
C. Plants should not be placed on sunny windowsills
D. Plants do not live very long

Answers

The conclusion is that plants need a certain amount of water to live. Therefore, option B is correct.

What is the effect of water on the life of a plant?

Water is a very important factor that affects the life of a plant. Water is required by plants to perform photosynthesis, through which they make food. If a certain amount of water does not available for plants then they will dry due to lack of food.

It is also required for the cooling and transportation of minerals and nutrients in the plant.

Plants need a certain amount of water to live. Therefore, option B is correct.

Learn more about the effect of water on plants, here:

https://brainly.com/question/28819470

#SPJ1

1 Identify Unscramble the letters below to find some landforms that result from the movement of tectonic plates and related forces.

FTIR ELALYV

NALIVCCO LIDNAS

UFATL-CLBOK OMTANNIU

COVNALCI UPAATEL

DOLEDF TNUMANIO

Answers

The scramble letters of the landforms that result from the movement of tectonic plates and related forces are:

Fault-line valleyVolcanic islandFault-block mountainContinental plateFold mountain

What is the  movement of tectonic plates?

The letters that is provided or spell out several landforms that result from the movement of tectonic plates and related forces are defined below:

"Fault" refers to a crack in the Earth's crust where two tectonic plates have shifted against each other. This movement can cause the land on either side of the fault to be raised or lowered."Valley" refers to a low-lying area of land between mountains or hills. Valleys can be formed by a variety of processes, including erosion caused by rivers or glaciers, or by tectonic activity that causes the land to sink."Volcano" refers to a geological feature that occurs when magma from the Earth's interior rises to the surface, forming a mountain-like structure that can erupt with ash, lava, and other materials. Volcanoes are usually found at the boundary between tectonic plates.

Also, the "Fault-block" refers to a landform that is created when a block of land is raised or lowered along a fault line. The block that is lifted is called a horst, the block that sinks is called a graben

Learn more about tectonic plates  from

https://brainly.com/question/1162125

#SPJ1

How do I write an email confessing love to a 6 year old?

Answers

Answer:

say "-anonymous if u ain interested or fbi"

Explanation:

How fast does evolution occur?

Question 1 options:

From one generation to the next

After multiple generations

Immediately

Answers

Answer:

It takes a million generations or more to evolve lasting changes, a study found

Explanation:

the answer would probably be a after multiple generations

What is the end result of mitosis?

A) one cell with two identical copies of DNA
B) two cells with different copies of DNA
C) one cell with two different copies of DNA

Answers

Answer:

A) one cell with two identical copies of DNA

Explanation:

The end result of mitosis is one cell with two identical copies of DNA.

Answer: A) one cell with two identical copies of DNA

Explanation: Mitosis is a process of cell division that occurs in somatic cells (non-reproductive cells). It involves a series of steps that result in the formation of two identical daughter cells.

During mitosis, the parent cell undergoes several stages: prophase, metaphase, anaphase, and telophase. In prophase, the DNA condenses into visible chromosomes, and the nuclear membrane begins to break down. In metaphase, the chromosomes align in the middle of the cell. In anaphase, the sister chromatids separate and move towards opposite poles of the cell. Finally, in telophase, the nuclear membranes reform around each set of chromosomes, and the cell begins to divide.

At the end of mitosis, each daughter cell contains the same number and type of chromosomes as the parent cell. This means that each daughter cell has an identical copy of the parent cell's DNA. The division of the cytoplasm then occurs in a process called cytokinesis, resulting in two separate daughter cells.

Learn more about mitosis here: https://brainly.com/question/9809645.

Which of the following characteristics are associated with transformed cells? Check All That Apply decreased growth ratedecreased growth rate altered chromosomesaltered chromosomes changes in cell surface moleculeschanges in cell surface molecules diminished capacity of cells to dividediminished capacity of cells to divide integration of viral DNA into host chromosomeintegration of viral DNA into host chromosome

Answers

Answer:

b. Altered chromosomes.

c. Changes in cell surface molecules.

e. Integration of viral deoxyribonucleic acid (DNA) into host chromosome.

Explanation:

A cell can be defined as the fundamental or basic functional, structural and smallest unit of life for all living organisms. Some living organisms are unicellular while others are multicellular in nature.

A unicellular organism refers to a living organism that possess a single-cell while a multicellular organism has many (multiple) cells.

Generally, cells have the ability to independently replicate themselves.

In a cell, the "workers" that perform various functions or tasks for the survival of the living organism are referred to as organelles. Some examples of cell organelles found in all living organisms such as trees, birds, and bacteria include; nucleus, cytoplasm, cell membrane, golgi apparatus, mitochondria, lysosomes, ribosomes, chromosomes, endoplasmic reticulum, vesicles, etc.

Transformed cells refer to cells that have undergone genetic alterations and as such do not experience normal cell processes or characteristics such as differentiation, division, and growth.

The characteristics which are typically associated with transformed cells include the following;

I. Altered chromosomes. Chromosomes are found in the cell nucleus and are comprised of deoxyribonucleic acid (DNA), histone proteins, etc. Thus, they are used to store genetic informations in living organisms.

II. Changes in cell surface molecules.

III. Integration of viral deoxyribonucleic acid (DNA) into host chromosome.

PLEASE HELP QUCIK!!

What is the genotype for
Mendel's recessive allele true breeding short plants?

A. TT

B. Tt

C. tt

Answers

The answer is

C. tt

Explained in the picture below of all the other choices and why tt is the short allele.

describe the climate in coastal area near a warm ocean current

Answers

Answer:

The climate in coastal areas near a warm ocean current has higher temperatures as its moving away from the equator. The warm ocean currents cold water sinks which then allows light warm water to flow to the opposite direction usually away from the equator.

Explanation:

I would try putting in your own words and your own twist but hopefully this helps

The climate in coastal area near a warm current will warm and rainy. The coastal regions will be maintained in a moderate temperature by warm current

What is warm ocean current?

Warm currents are heat transferring wind flowing from ocean parallel to the tropical and sub-tropical regions. Warm ocean current results in summer rainfall in the surrounding areas.

North Atlantic drift and Canary currents are examples of  warm ocean currents. They are responsible to bring a moderate temperature level in coastal areas.

Warm ocean currents may sometimes mix with cold currents creating foggy weather in the near areas. Thus cold and dry climate may result in that areas.

Therefore, in general, warm ocean currents make the surrounding coastal areas in a moderate temperature with summer rainfall.

To learn more about warm currents, refer the link here:

https://brainly.com/question/16403291

#SPJ2

A herd of zebra currently has 45 members. Based on the available resources,
biologists estimate that the size of the herd will increase at a rate of 7% per
year.
Which of the following graphs models this relationship, if the x-axis
represents years and the y-axis represents number of zebra?

Answers

In this instance, the zebra population will grow by 7% year, which suggests that growth has been accelerating ever since the number was counted.

Where are zebras found in India?

LUCKNOW: On Thursday, three zebras moved into the zoo's enclosure, which had been empty for the previous six years. The most widespread zebra species in the world is the Grant's zebra.

India bought the cheetah, right?

A Boeing 747 will be used to transport the cheetahs. According to representatives from the ministry of environment, forest, and climate change, a total of Rs 96 crore has been set aside for the project (MoEFCC). Indian Oil has contributed an additional Rs 50 crore to the project.

To know more about zebra  visit:-

https://brainly.com/question/17206631

#SPJ1

Comment on the difficulty of describing a virus as a living organism.

Answers

Answer: You can't describe a virus as a living organism...it's not living!

A virus needs a host to survive and replicate itself to create a illness. It invades a cell by attaching itself onto it and injects its DNA into the cell. Afterwards, the cell bursts and creates the new virus replica. Every cell that is affected by a virus always dies.

A hypothesis that is scientific must have a test for proving it

Answers

Answer:

True

Explanation:

If it is a scientific hypothesis, then it has to be tested.

Identify a dependent variable measured in the researcher’s experiment. Identify one control that the researcher could use to improve the validity of the experiment. Justify the researcher analyzing blood samples at many intermediate time points instead of at only the beginning and the end of the 20-week period.

Answers

Answer:

The dependent variable measured in the researcher’s experiment is the concentration of the drug in the blood samples. One control that the researcher could use to improve the validity of the experiment is to ensure that the same amount of the drug is administered to each participant.

Analyzing blood samples at many intermediate time points instead of at only the beginning and the end of the 20-week period allows the researcher to track changes in the concentration of the drug over time. This gives a more accurate picture of how the drug is metabolized by the body and how it affects the participants.

Explanation:

Other Questions
Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA The table below shows information about how many fans there were at twofootball matches in a local tournament.What is the difference between the number of away fans at the semi-final and atthe final?Semi-finalFinalTotal number of fans250400Ratio of home fansto away fans6:47:3 Follow the constitution and the law even if I disagree with it what power or duty is this listed on Nika rolls an 8-sided cube with faces numbered 1 through 8. Which of the following statements is true? P(even number) = P(odd number) = P(number less than 8) = 1P(the number 9) = 1 Why might Great Britain's colonies have contributed tothe start of Ine Industrial Revolutionin Great Britain? What is irony What are the 3 types of irony and examples of each? Which question is a statistical question?A. How tall is the oak tree?B. How much did the oak tree grow in one year?C. What are the heights of the oak trees in the schoolyard?D. What is the difference in height between the oak tree and the pine tree? HELP FOR MY FINAL PLEASE PLEASE In a random sample of 70 people, it was found that 44 of them were fans of the New York Yankees. What is the margin of error for the true proportion of all individuals who are fans of the New York Yankees? A. 0.0088 B. 0.058 C. 0.063 D. 0.116 E. 0.173 Which sentence is the most formal?A. Hi! Do you have any job openings at your work yet?O B. I would like to apply for the administrative position at yourcompany.C. I think it would be really fun to work at your company.D. Please hiring my person for the open position you got in yourestablishmentLIDT TCS the scrum team is using the KANBAN board to make work visually availible to all. What cannot be inferred from the board You can find Maya Angelou's many poetry volumes in most bookstores. What word or phrase is modified by the prepositional phrase in this sentence? What statements about prisms are always true if the top base is directly above the bottom base? Select all that apply. The lateral faces are rectangles. The bases are congruent. The bases can be any shape. The lateral faces are congruent. What is the function of a claim in an argument evaluating an argument? Did slaves have unalienable rights? Categories of books that focus on various aspects of human nature are known as A. genres.B. novelsC. novellas. D. themes. The ___ gave the Triple Entente a fresh advantage once their soldiers entered the war. 1. United States2. Russians3. French4. Germans PLS HELP WILL GIVE BRAINLIESTIf a sprinkler waters 1 over 15 of a lawn in 1 over 3 hour, how much time will it take to water the entire lawn? 5 hours 15 hours 18 hours 45 hours $1,500 in investment account with 8.5 percent interest A gift box in the shape of a rectangular prism has 20-inch length, 14-inch width, and 10-inch height. How much paper will you need to wrap the gift box?