a speech on the topic Language Should Build Bridges not create borders​

Answers

Answer 1

you may want to start the speech by talking about a time when someone you cared about misunderstood you

building bridges is like diplomacy . its very important

borders are man made


Related Questions

Is: Watch out for the wet paint! Is it a sentence or a fragment ?

Answers

Answer:

Its a sentence

Explanation:

Because fragments are broken up words. ... im so confused !!! ... but if it was a sentence it would a subject and predicate. report flag outlined.

Which of the following examples best represents a metaphor?
A. He did not believe me when I told him his eyes were like pools of
canola oil.
B. The soda was as cold as a Minnesota winter on my teeth.
C. She did not believe me when I told her her lips were like
sandpaper.
D. The windows were eyes with cataracts; we could not see the
ocean.

Answers

Answer:

B

Explanation:

Looks like the best option

p please find this Answer I give brainliest​

Answers

Answer:

1. why didnt he tell us about them when he came yesterday

2. it is likely that we shall be in time to see her when she arrives

3. please give me the message for him

4. my friend and I went to see her to ask her about her brother

Explanation:

I know how to speak English

Answer:

Australia n bro what are you doing

Write a story from the perspective of Grendel, the monster in Beowulf. The narrative must include plot and characterization that both center on a strong conflict.

Answers

Answer:

Grendel was a monster, misunderstood and maligned by the humans who lived in the kingdom of Hrothgar. They saw him as a beast, a creature of darkness and destruction, but Grendel knew that he was so much more than that.

As he roamed the moors and forests, Grendel couldn't help but feel a sense of frustration and anger. He had been cast out by his own kind, rejected by the other monsters because of his great size and strength. He was alone in the world, with no one to turn to and no place to call home.

But Grendel didn't let his loneliness and isolation consume him. Instead, he channeled his emotions into a burning desire for revenge. He would show the humans that he was not to be trifled with, that he was a force to be reckoned with.

And so, Grendel began his rampage. He attacked Hrothgar's great mead hall, killing and maiming anyone who crossed his path. The humans were terrified of him, and for good reason. Grendel was a formidable foe, with skin as hard as steel and claws that could tear through even the strongest armor.

But despite his fearsome reputation, Grendel was not invincible. He had a weakness, one that he had tried his best to hide from the world. Grendel was deathly afraid of fire. It burned him, searing his skin and causing him unimaginable pain.

This fear would prove to be Grendel's undoing. As he rampaged through the mead hall, a young warrior named Beowulf caught sight of him. Beowulf was a skilled fighter, with a heart as brave as it was true. He knew that he had to defeat Grendel if he wanted to save the kingdom and its people.

And so, a fierce battle ensued. Grendel and Beowulf fought with all their might, each determined to come out on top. In the end, it was Beowulf who emerged victorious, having used Grendel's fear of fire to his advantage.

As he lay dying, Grendel realized that he had been wrong all along. He was not a monster, but a creature of flesh and blood, with fears and desires just like any other being. And in his final moments, he found peace in the knowledge that he was not alone, that there was someone who had understood him, if only for a fleeting moment.

Explanation:

We are going to the mall tomorrow underline the verb phrase circle the main phrase

Answers

The lexical verb and the principal verb are other names for the main verb. This term refers to the sentence's important verb, which typically reveals the subject's action or state of being.

Main verbs can be used by themselves or in conjunction with a helping verb, also known as an auxiliary verb.

We are going to the mall tomorrow - are is verb.

What is a good illustration of a main verb?

Give a few illustrations of main verbs. Eat, drink, move, talk, have, have had, am, is, take, keep, need, try, and so on, are a few verbs that function as main verbs.

To learn more about conjunction here:

https://brainly.com/question/28839904

#SPJ1

Evidence that truth can be dangerous in The Things They Carried

Answers

A good war story is never genuine, the narrator claims in Tim O'Brien's novel this is the Evidence that truth can be dangerous in "The Things They Carried".

What exactly is The Things They Carried's happening truth?

O'Brien famously distinguishes between "narrative truth," or readers' actual experience of the story, even if the specifics are made up, and "happening-truth," or an authentic and verifiable description of historical events, throughout The Things They Carried. "In battle you lose your sense of the definite, so your sense of truth itself," writes O'Brien (Reader 181). O'Brien makes this point by using the ambiguity of truth as a rhetorical tactic. The things they carried. After initially claiming that everything in the book is factual, he now acknowledges that almost everything is fiction.

Learn more about the evidence here: https://brainly.com/question/375033

#SPJ1

Imagine your future son is thinking about illegal migration. He is planning to go to Libya and then into Europe by boat. Give him some advice.​

Answers

Answer:

Well, it really depends on how bad it is where you are. Some advice you could give is to tell him to think long and hard because he would be leaving his home and life and he would probably never be able to come back.

Explanation:

PLEASE HELP ME THANK YOUUU

-when did you need to use subtlety why

Answers

Answer:

Explanation:

How to use subtlety in a sentence. ... The pianist performed with subtlety and passion. we appreciated the subtlety ... in the examples do not represent the opinion of Merriam-Webster or its editors. ... What made you want to look up subtlety?

CEER: What type of conflict is Ponyboy experiencing on page 92-93 of
chapter Six? Use evidence to explain your answer.

Answers

Answer:

Explanation:

Dally relates to the two boys how worried the gang is about them. Johnny just keeps asking whether his parents have been worried. Dally avoids the question as long as he is able, but then has to admit to Johnny that, no, his parents have not asked about him. Johnny doesn't say anything, but looks devastated. Driving back from Dairy Queen, they spot the church on fire. A group of people stands around the church; a school evidently out on a picnic, and Ponyboy and Johnny jump out of the car to find out what's happening. As they arrive on the scene, one of the women shouts that some of the children are missing.

Both Ponyboy and Johnny leap through a window in search of the kids. An older man — later identified as Jerry Wood — follows them, but he is unable to get through the small window. The boys quickly find the kids and hand them out through the window to safety. Dally is now on the scene and he warns the boys to get out because the roof is starting to cave in. After dropping the last kid out the window, Johnny shoves Pony out the window, and the roof collapses. Pony blacks out, but Dally goes back inside for Johnny.

When Ponyboy regains consciousness, he hears sirens. He assumes that he is in a police car until Jerry Wood (who accompanies him) tells him that they are in an ambulance, and Johnny and Dally are in the ambulance behind them. Dally has a badly burned arm, but Johnny is in far worse condition, with a possible broken back and bad burns. They are all considered heroes for saving the children. At the hospital, doctors examine Ponyboy, and except for a few burns and a big bruise across his back, he's fine. He is in the waiting room, worried about Johnny and Dally, when Darry and Soda arrive. Soda gives Pony a great big bear hug, and Darry stands back with his hands dug into his pockets. When Pony looks at Darry he sees that he is crying. In that split second, Ponyboy realizes that Darry does care for him, that he was just trying too hard. After losing his parents, Darry fears losing another loved one.

Analysis

Cherry's willingness to clue the greasers in on Soc activity shows her to be in a kind of limbo. She is no longer affiliating herself as a Soc, but instead is watching them as an outsider. However, the gang definitely does not consider her to be a greaser, because she is merely reporting to them to prevent any more fights between the rival groups. This existence, not being affiliated with one group or another, can be a scary one. It is especially frightening to adolescents who use the group mentality as a barometer of their own self worth. However, sometimes it is necessary to step outside of one's own comfort zone to stand up for an issue in which you believe. This is what Cherry is doing: Tired of the fighting and the gang mentality, she attempts to resolve the many perceived differences that separate the two groups.

This turn in Cherry's personality in some ways more closely aligns her with Dally. Dally is a greaser, but he is the most outcast of the group. He is the only one who has ever been in serious trouble, and he is the only one whom everyone in the group, including Darry, is afraid of: "Not even Darry wanted to tangle with him. He was dangerous," Ponyboy remembered.

Hinton describes Dally's hair as "white"-blond" a good color for someone who could be an outsider from all groups. White contains all of the visible rays of the color spectrum. It is a crossover color that cannot be affiliated with anyone. If Hinton were to write a sequel using Dally and Cherry, it would be easy to draw an analogy between them and Romeo and Juliet. Both couples are teenagers who come from different worlds. Romeo and Juliet deal with feuding families who oppose their relationship, and Dally and Cherry battle opposing gangs.

The perception that the three boys are heroes goes beyond gang lines. (The power of three is a theme that is prevalent throughout Western literature.) Three greasers, whom Bob had defined as "white trash with long hair," seemingly defy all stereotypes and risk their lives to save some children. This is a concept that Ponyboy thought no one could believe. Ponyboy explains the events to Jerry Wood — from the drive-in theatre, to the killing, to their escape — but Wood does not change his perception of the bravery displayed by Johnny, Pony, and Dally. Ponyboy notes of Wood, "He didn't seem to mind our being hoods."

Read the passage. There are several questions about this passage.
whether formed by water run-off, deer, or wild turkey, every path seemed to
be a desire path.
2
But when we were some hundred feet below the ridge line, the signal
picked up, and its steady, loud chirping took us to the old black locust tree,
seventy or maybe seventy-five feet tall, with cracks and fissures in its deeply
furrowed bark that made it an accommodating roost. A pamphlet from the US
Fish and Wildlife Division of the Department of Environmental Conservation
describes the Indiana bat as having fur that is "dull grayish chestnut rather
than bronze, with the basal portion of the hairs of the back dull lead colored.
This bat's underparts are pinkish to cinnamon, and its hind feet small and
delicate." I saw nothing like this, but when we listened very carefully, we could
hear their hum of gentle chattering. Bats use sound to situate themselves;
their capacity for echolocation is what guldes them, what elucidates their
sense of space and substance, what locates their prey. But the sound, a series
of tiny clicks ten or twenty, forty or even two hundred times a second, is at a
frequency beyond most human hearing; it is exactly that high frequency with
its short wavelengths that produces the detailed echoes the bats rely on to
learn the shape of their universe. We live in an acoustical empire we will never
know, our threshold of hearing situated somewhere between the low,
Infrasonic rumbling of elephants and the high-pitched ultrasonic rasping of
tenrec shrews that rub their quills together to communicate. I knew that the
subtle whispering I could make out was but a fraction of the sound sensation
the bats were creating and, listening to the soft murmuring, felt I was standing
at the gate to a remote kingdom of sound that could only be imagined.
In paragraph 2, how are elephants and tenrec shrews
related to the human "threshold of hearing"?
1. These animals illustrate the lowest and highest
sounds that most humans can hear.
2. These animals make some sounds that are
outside the range of human hearing.
3. These animals can hear sounds that most
humans and bats are also likely to hear.
4. These animals are like humans in their ability to
hear the range of sounds made by bats.

Answers

The threshold of hearing means 2. These animals make some sounds that are outside the range of human hearing.

What is this passage about?

In the passage, a bat hunt in the wild is described. They determined that an ancient black locust tree was an Indiana bat roosting site after the author and his team received a signal that sent them there. Although they couldn't see the bats, the author adds that they could hear their soft chattering. They observe that to locate themselves and find prey, bats use sound, particularly echolocation. The frequency of the clicks that bats make is higher than most people can hear, and it's this higher incidence that enables the bats to hear precise echoes and comprehend the contours of their surroundings. The passage also briefly indicates that the range of human hearing is between the deep infrasonic rumble of elephants and the strong ultrasonic rustling of tenrec harpies that rub their feathers together to communicate.

To know more about bats, visit:

https://brainly.com/question/8745577

#SPJ1

Select the correct answer. Read paragraph 5 from the passage. [5] Down the long lane of the history yet to be written America knows that this world of ours, ever growing smaller, must avoid becoming a community of dreadful fear and hate, and be, instead, a proud confederation of mutual trust and respect. What is the meaning of confederation as it is used in paragraph 5? O A. O B. O c. amalgam compound alliance O D. corporation​

Answers

The context clues show that the meaning of confederation as it is used in paragraph 5 is C. alliance.

What are context clues?

When determining a word's meaning, context clues take into account the words that immediately precede the unknown word and lead us to infer its meaning.

In order to broaden one's vocabulary and aid in the interpretation and understanding of a message or concept, this means that they help infer the meaning of unknown words using the meanings of words that are close by.

In this case, the context clues show that the meaning of confederation as it is used in paragraph 5 is alliance. The correct option is C.

Learn more context clues on:

https://brainly.com/question/11247029

#SPJ1

For if dreams die / Life is a broken-winged bird/ That cannot fly.

Answers

Answer:

This is a metaphor from the poem "Dreams" by Langston Hughes. It suggests that if one's dreams die, then life becomes meaningless and joyless, like a bird that cannot fly.

Explanation:

of stion Complete the following sentences using the Simple Past form of the verb in parentheses. (Use contractions if possible.) 1. It was warm, so I took 2. The film wasn't very good. I didn't enjoy 3. I knew Sarah was very busy, so I didn't disturb 4. I was very tired, so I went to bed early. (go) 5. The bed was very uncomfortable. I didn't sleep 6. Sue wasn't hungry, so she didn't eat off my coat. (take) 7. We went to Kate's house but she didn't is 8. It was a funny situation but nobody laughed 9. The window was open and a bird you understaund 10. Did Please answer all parts of the question. it very much. (not/enjoy) her. (not/disturb) very well. (not/sleep) anything. (not/eat) home. (not be) . (laugh) into the room. (fly) (understand) yesterday's English lesson?​

Answers

The simple past form of the verb in parentheses will be:

Yes, I understood yesterday's English lesson.

What is verb?

A  verb is a word that is used to describe an action, state, or occurrence. It is one of the main parts of speech in the English language. Verbs indicate when an action has taken place, is taking place, or will take place. Verbs can also be used to describe the state of being of a noun or pronoun. Verbs are used to express physical actions, mental actions, or states of being. Examples of physical actions are run, jump, and eat. Examples of mental actions are think, believe, and hope. Examples of states of being are am, is, and were. Verbs can be regular or irregular. Regular verbs are verbs that follow a specific pattern when conjugated. Irregular verbs are verbs that do not follow a specific pattern when conjugated. Verbs can be classified as transitive, intransitive, auxiliary, modal, and phrasal.

To learn more about verb
https://brainly.com/question/1718605

#SPJ1

Q39 1984: Which technique does the writer use as the excerpt closes in order to demonstrate Winston’s point of view?

Select one:
a. symbolism
b. sarcasm
c. metaphor
d. irony

Answers

Answer:

sybolism

I describes the ending of how it took place

In his descriptions of Santiago's efforts to maintain his strength and keep his focus, Hemingway captures __________.


the joy Santiago feels whenever he is alone on the ocean


the hatred for nature that drives all fishermen and hunters


the difficulty and seriousness of Santiago's task


the natural beauty and total serenity of the ocean

The fact that both Santiago and the fish must struggle through pain while fighting each other suggests __________.

the superior strength of the fish and other animals


the growing bond between the two of them


the loyalty that both feel to their companions


the destructive cruelty of human beings

Santiago likes and identifies with the sea turtles for all the following reasons except __________.

sea turtles prey on the dangerous Portuguese men-of-war in the ocean


sea turtles fight off sharks that prey on fishermen and their catch


Santiago has a heart and hands and feet just like sea turtles do


Santiago eats the white eggs of sea turtles to give himself strength

How does Hemingway depict Santiago as the old man sets out on the skiff?


Hemingway depicts Santiago as one who used to enjoy nature but now feels betrayed by the ocean.


Hemingway depicts Santiago as one who understands nature and feels comfortable alone on the ocean.


Hemingway depicts Santiago as one who wants to destroy nature and feels angry when alone on the ocean.


Hemingway depicts Santiago as one who mistrusts nature and feels frightened when alone on the ocean.



Why are readers inclined to view Manolin as a sympathetic figure in the novel?


Manolin is the story's narrator, so readers see people and events through the boy's eyes.


Manolin is far luckier than Santiago, and he catches many fish without the old man.


Manolin treats Santiago with great respect and affection.


Manolin is frequently chastised and rebuked by Santiago.

Answers

Answer:

the difficulty and seriousness of Santiago's task

the growing bond between the two of them

Santiago eats the white eggs of sea turtles to give himself strength

Hemingway depicts Santiago as one who understands nature and feels comfortable alone on the ocean

Manolin treats Santiago with great respect and affection.

Explanation:

According to the book The Old Man and the Sea by Ernest Hemingway, the author describes the life of the protagonist Santiago and his struggles with fishing and the taunts of other fishermen.

Santiago has a young disciple Manolin, who has been faithful to the old man and stayed on with him even when he went 84 days without making a catch.

The old man (Santiago) is unlike the other fishermen and likes to lay his bait in a precise and orderly manner

Pick a correct sentence:

a) Uncle Matt and ms. Elizabeth are going to attend Ben’s Birthday!
b) “Der Spiegel” is a renowned magazine.
c) Being in danger activates our fleeing reflexes.
d) I hate how always disagrees when he should have supported me!

Answers

The right response to the above statement is that being in danger triggers our instinct to run.

A reflex behavior is what?

A reflex is an automatic, or involuntary (say: in-VAHL-un-ter-ee), bodily response to an event that occurs without your conscious thought. Your leg just kicks; you don't choose to kick it. A response is an uncontrollable movement that happens very instantly in reaction to a stimuli. The reflex, which happens throughout a reflex arc, is an involuntary reaction to a stimuli that doesn't require or receive conscious cognition.

Which of these 3 types of reflexes are they?

Reflex of sucking (sucks when area around mouth is touched) startle reaction (pulling arms and legs in after hearing loud noise) Foot reflex (stepping motions when sole of foot touches hard surface).

To know more about Reflexes visit :

brainly.com/question/30079893

#SPJ1

What is the suffix in the word "consideration ?*​

Answers

Answer:

The suffix of coonsideration is consideration

Explanation:

That is my favorite subject english

WORTHH 75 POINTS AND MARKED BRAINIEST IF DONE RIGHT !!!
Drew Brophy: Living Life His Way
Prompt
Writers often use titles to introduce a central idea in a text. Write an essay
analyzing why the title is appropriate for the passage. Use evidence from the
text to support your response.

Answers

Grabbing the reader's attention and compelling them to read the lead-in are the two goals of a title. Set expectations for the content by predicting it. Set a tone by creating a setting that is appropriate for the WORTHH 75 POINTS AND MARKED BRAINIEST IF DONE RIGHT !!!, Drew Brophy: Living Life His Way.

Drew Brophy's residence is unknown?

In 1996, Brophy relocated to California for work after spending the 1990s living and surfing in Hawaii. His wife and son now reside with him. At the age of 50, he has been creating work for more than three decades.

Drew Brophy's source of inspiration?

Because of his passion for surfing, Drew has dedicated himself to learning about the weather, how it affects waves, and how the sun affects the planet. His interest in physics has grown as a result of all of this, and it has affected his paintings.

To know more about Drew Brophy visit :-

https://brainly.com/question/28317178

#SPJ1

This photo was taken during the Great Depression.

A truck carrying furniture and luggage.

Imagine that the caption for this photo explained that this family was moving to a brand-new home. How would that information most likely affect a reader?

It would most likely make the reader feel happy for the family.
It would most likely make the reader feel angry at the family.
It would most likely make the reader feel afraid for the family.
It would most likely make the reader feel concerned for the family.

Answers

The photo taken during the depression, that information would most likely make the reader feel happy for the family.

What was the Great Depression?

The Great Depression was a time in the America, where all the stock were gone down, and people suffered due to lack of money and the economy was fell.

Thus, the correct option is A, It would most likely make the reader feel happy for the family.

Learn more about the Great Depression

https://brainly.com/question/27291778

#SPJ1

Answer:

It would most likely make the reader feel happy for the family. basically a.

Explanation:

edge 2022

By placing female characters in school in Hard Times, Charles Dickens is suggesting that he is____.

utilitarian
Victorian
progressive
conservative

Answers

Answer: Progressive
Progressive - happening or developing gradually or in stages proceeding step by step

5. Which phrase from the story best indicates the historical period in which the events take place?
A) and in the open field back of the sawmill the Prussian soldiers were drilling
B) but, of course, that day everything had to be as quiet as Sunday morning
C) All at once the church-clock struck twelve
D) For forty years he had been there in the same place

Answers

D) For forty years he had been there in the same place is the best phrase to indicate the historical period in which the events take place because it gives a specific time frame of 40 years. This helps to narrow down the time period in which the events of the story could have taken place.

Which of the following options best describes the purpose of the following passage (paragraph 3)?
Utsav is an example of one of the many new-style Indian restaurants that have begun opening in
both America and Britain. In London restaurants such as Veeraswamy's and Zaika are examples of
this new trend, the results of a new breed of Indian chefs making a bid to elevate Indian food from
its status as cheap nosh to an elegant cuisine, every bit as sophisticated as French cookery. On
both sides of the Atlantic, these high-class restaurants place great value on the authenticity of their
food. The chefs are often specially trained in India and cook only dishes from their home region.
Even the more traditional restaurants are beginning to follow this trend and advertise their dishes as
"authentic." Supermarkets, too, offer an "authentic" Indian experience with every ready-prepared
Indian meal. But what does authenticity really mean? And is authenticity really the right yardstick by
which to judge an Indian meal?
A. The passage provides the inspiration behind Collingham's search for "authentic" Indian cuisine.
B. The passage introduces the cultural text that frar Collingham's argument.
C. The passage provides Collingham's opinions of a few fancy Indian restaurants.
D. The passage presents Collingham's argument against the concept of an "authentic" Indian cuisine.

Answers

We can see here that the option that best describes the purpose of the given passage is: D. The passage presents Collingham's argument against the concept of an "authentic" Indian cuisine.

What is the purpose of a passage?

The purpose of a passage usually tells us what the writer of the passage is actually trying to achieve.

When an author is attempting to explain or inform readers, it is a purpose they want to achieve by giving facts about a specific subject or instructions. The author's intention is to persuade if a reading section has a lot of opinions or seeks to persuade readers to buy something, do something, or believe something.

We see here that option D tells us the purpose of the passage. It is very clear that it presents the argument of Collingham against the concept of an  "authentic" Indian cuisine.

Learn more about purpose of a passage on https://brainly.com/question/14945507

#SPJ1

Please help I’ll mark brainlest

Answers

Answer:

"Hey Ash!" yelled Sebastian. Turning around, Ash smiled at Sebastian as he cleaned the floors. "When do you think you will be done?" asked Sebastian while eating his chips. Ash looked at Sebastian and his chips, "please don't make a mess" Ash pleaded to Sebastian. "Relax!" Sebastian exclaimed, still crunching on his chips. Ash sighed and continued cleaning while Sebastian sat down and read his school book. "I'll be done within a hour, Sebastian" Ask groaned. When Ash was finished, he nudged Sebastian and quietly spoke "let's go", before leaving the building.

Not sure if there was suppose to be a story but if you need the dialogue only then here it is.

"Hey Ash!" yelled Sebastian.

"When do you think you will be done?" asked Sebastian.

"Relax!" Sebastian exclaimed, still crunching on his chips.

"Please don't make a mess," Ash pleaded to Sebastian.

"I'll be done within a hour, Sebastian" Ask groaned.

When Ash was finished, he nudged Sebastian and quietly spoke "let's go", before leaving the building.

*
What has lago talked Roderigo into doing?

Answers

Answer:

In this quote, Iago is constantly urging Roderigo to side with him in bringing down their common enemy, Othello. He is stating that his cause is sincere and heart-felt towards helping him win Desdemona. He is also telling Roderigo to literally go out and make money, and in exchange he'll have Desdemona under his arm.

Explanation:

hello:)

Iago talked Roderigo to "put money in thy purse". He assures Roderigo that Desdemona will be in his hands (Roderigo's). Iago also asserts that he will trap and bring the downfall of Othello making him believe that Desdemona and Cassio are having an affair.

Hope it helps!

The
THE TRUE FALSE SHOW
1 Mosquitoes are more dangerous than sharks.
2
Brown eggs are healthier than white eggs.
3 The Earth is hotter than Mars.
4 Coffee is more popular than tea in the UK.
5 Tigers are better swimmers than cats.
6
An adult is shorter in the morning than in the evening.
7 White cars are safer than yellow cars.
8
The word 'yes' is more common than the word 'no'
.​

Answers

Answer:

1. True. Mosquitos cause way more deaths than sharks do, because mosquitos transmit diseases like Malaria. This is also because shark attacks are extremely rare.

2. False. There is no nutritional difference between brown and white eggs.

3. True. Mars only reaches a temperature of about 68°F.

4. False. Tea is more popular than Coffee in the UK.

5. True. Tigers are much more agile in the water than domestic cats.

6. False. You can be taller in the morning than in the evening due to gravity compression.

7. True/false? Some studies have shown that yellow cars are safer than white cars, however overall most studies show that white cars are the safest color.

8. False. 'No' is more universally used (more common) than yes.

Explanation:

This took a long time to write.

What sentence is punctuated correctly?
O The birds, lined up in a colorful row, chirped a merry spring song.
O The groom after brushing the horse down thoroughly, led it to the stall and fed it.
O Lisa, afraid of looking foolish in her rain-saturated hat hid behind the plant in the hall.
O The champion months after finishing, first in all his races, displayed his trophies.
9
10
11 12 13 14
15 16 17 18

Answers

Answer:

The birds, lined up in a colorful row, chirped a merry spring song.

Explanation:

The commas were in the wrong place for the other ones. If you read it aloud, pausing where the commas are, this answer is the only one that makes sense.

Answer and Explanation:

The answer is the first option:

The birds, lined up in a colorful row, chirped a merry spring song.

This sentence flows correctly and the commas are in the correct positions. For the other sentences, the commas, or lack of commas, disrupt the flow of the sentence and it makes it sound weird.

#TeamTrees #PAW (Plant And Water)

Also, give the user above me Brainliest because they answered first, correctly, and with a good explanation.

Two minutes ago the child was fast asleep, but now he is wide awake. What kind of a sentence is that

Answers

It is both a declarative sentence, it is a statement, and a compound sentence, it has more than one independent clause.

Answer:

Nope he is right lol it's compound sentence.

How can someone sharpen their critical thinking skills?

Select one:

a.
develop your plan of action


b.
develop yourself as an analytical decision maker


c.
admit it when you don’t know


d.
think about your thinking

Answers

the answer would be alA

Why O'Brien lied to his daughter about killing someone in the war?

Answers

When she was nine years old, O'Brien's daughter Kathleen questioned him about if he had ever killed someone in the war. He declined, but he hopes she will ask again when she is an adult.

What is a war?

A war is a fierce armed struggle between two or more states, governments, society, or paramilitary organizations like militias, mercenaries, or insurgents.

Extreme violence, damage, and fatality, whether caused by conventional or irregular military forces, are typically its defining characteristics. The term "warfare" describes the typical actions and traits of particular war types or of wars in general.

Total war is defined as warfare that extends beyond solely military objectives and is capable of causing significant suffering and casualties among civilians and other non-combatants.

While some war studies experts believe that violence is an innate and universal component of human nature, others contend that it is a response to particular sociocultural, economic, or ecological conditions.

Learn more about war, here

https://brainly.com/question/3445478

#SPJ1

Are your smart?
Spell “it”

Answers

Answer:

i

t

Explanation:

Answer:

I+T IT :3

Explanation:

No im stu.pid

Other Questions
What is human trafficking Which of the following statements best explains differences between the finches? A. Some finches were born with beaks that allowed them to have better access to different sources of food. These finches reproduced and passed on their genes.B. The beaks of the finches changed so all of the finches could eat the same types of food.C. The beaks of the finches changed as the species of finches migrated to the same island.D. The beaks of the finches changed as the finches' body sizes changed. The characteristics of type one diabetes Factor quadratic trinomials2x^2+7x+63x^2+5x+2With method X pleaseee:( How do you graph a parent graph? Do you agree with Wittgenstein that philosophy should focus on language? Why or why not? Cultural differences that might influence the guest service experience include all of the following except diet greetings humor marriage What was the Selective Service Act and how did it impact the war? When considering the various resources factors of production which of the following is most likely to represent capital? Find the area. The figure is not to scale You can NOT have an in group without having an out group True False 3 chairs and 4 tables cost rs 7540. if the price of a chair is 220 find the price of table?ans - 7120 two equivalent ratios for 17:5? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA The table below shows information about how many fans there were at twofootball matches in a local tournament.What is the difference between the number of away fans at the semi-final and atthe final?Semi-finalFinalTotal number of fans250400Ratio of home fansto away fans6:47:3 Follow the constitution and the law even if I disagree with it what power or duty is this listed on Nika rolls an 8-sided cube with faces numbered 1 through 8. Which of the following statements is true? P(even number) = P(odd number) = P(number less than 8) = 1P(the number 9) = 1 Why might Great Britain's colonies have contributed tothe start of Ine Industrial Revolutionin Great Britain? What is irony What are the 3 types of irony and examples of each? Which question is a statistical question?A. How tall is the oak tree?B. How much did the oak tree grow in one year?C. What are the heights of the oak trees in the schoolyard?D. What is the difference in height between the oak tree and the pine tree?