A parallelogram has 6-cm and 8-cm sides. The height corresponding to the 8-cm base is 4.5 cm. Find the height corresponding to the 6-cm base.​

Answers

Answer 1

Answer:

The height of the parallelogram is 6 cm.

Step-by-step explanation:

Given,

base=4.5 cm.

area=27 CM sq

Now,

height = area/base

.: height =27/4.5 cm

=6 cm


Related Questions

Law of sines: Which measures are accurate regarding triangle JKL? Check all that apply. M∠K = 84° m∠K = 94° k ≈ 3. 7 units k ≈ 4. 6 units KL ≈ 2. 5 units KL ≈ 3. 2 units

Answers

The median's class interval is 20 hours and 30 minutes. And the average number of hours is thought to be 26.17.

Who defines median?

The median is the exact middle value of a dataset after it has been sorted. A measure of central tendency is the distance between the bottom 50% of data and the top 50% of values. The methods for determining the median will vary depending on whether you have an odd or even number of data points.

the class interval that have  median.

total is frequency is as -

∑f = 30

median class of corresponds to half of the value

∑th is the  value

i.e.  15th value.

least cumulative frequency higher than or equal to 15 is obtained by accumulating frequencies starting at the top.

[tex]2+8+9=19[/tex]

So, corresponds to the class interval  = [tex]20 < h\leq 30.[/tex]

Hence, median class is [tex]20 < h\leq 30.[/tex]

Since this is a grouped data we use the midpoint

The median:-

To know more about median visit:

brainly.com/question/28060453

#SPJ4

Write the name of the polynomial that is obtained when two polynomials are divided and leaves no remainder.

Answers

Answer:

smlnsılasınız

Step-by-step explanation:

ben biyoml sou rmifn ilpuanlazı m baan

a

What is the circumference of the circle? Use 7 for s. 35 cm 2 O 44 cm 55 cm 100 cm O 110 cm Mark this and return Save and Exit INT​

Answers

Answer:

55

Step-by-step explanation:

A package states that there are 60 calories in 12 crackers and 75 calories in 15 crackers. Since the relationship is proportional, how many calories are there in 180 crackers?

Answers

answer:
900 calories

step-by-step explanation:
there are 60 calories in 12 crackers or 5 calories per crackers
60/12 = 5
there are 75 calories in 15 crackers or 5 calories per crackers
75/15 = 5
if there are 180 crackers
180 • 5
900 calories total

answer:

900 calories

step-by-step explanation:

there are 60 calories in 12 crackers or 5 calories per crackers

60/12 = 5

there are 75 calories in 15 crackers or 5 calories per crackers

75/15 = 5

if there are 180 crackers

180 • 5

900 calories total

A barrel shaped like a cylinder is laid on its side and rolled up a ramp. The barrel has a circular base that is 1.1 inches in diameter. If the barrel turns 47 times in being rolled up the ramp, how long is the ramp?

Answers

The length of the ramp is 161.62 inches when the barrel turns 47 times in being rolled up the ramp.

What is the Circumference of a circle?

The Circumference of a circle is defined as the product of the diameter of the circle and pi.

C = πd

where 'd' is the diameter of the circle

The circumference of the circular base of the barrel is given by the formula C = πd, where C is the circumference and d is the diameter of the base.

In this case, d = 1.1 inches, so C = π1.1 inches = 3.46 inches.

Since the barrel turns 47 times, the distance it travels is 47 times the circumference of the base,

47 × 3.46 inches = 161.62 inches

Therefore, the length of the ramp is 161.62 inches.

Learn more about the Circumference of the circle here:

brainly.com/question/19794723

#SPJ1

Please help no links please!!!!!

Answers

The first one is 200 cause 360-160=200 cause it is the arc

Find the exact area of a circle with diameter of 10 units.
10
100
5
25

Answers

Here ^^

--------------

A≈78.54

to be exact it would be 25

--------------

bye have a good morning/afternoon/evening!! <3

- berry

Step-by-step explanation:

the area of a circle with the diameter of 10 is 78.5

Solve each equation by taking square roots. Show your work. Simplify your answers. Do not write your answers in decimal form.

Answers

Answer:

1) n=±2[tex]\sqrt{5}[/tex]

2) a=±3[tex]\sqrt{10}[/tex]

Step-by-step explanation:

1) [tex]n^{2}[/tex] =20

✰Take the square root of both sides n=±[tex]\sqrt{20\\}[/tex]

✰ Simplify [tex]\sqrt{20\\}[/tex] to 2[tex]\sqrt{5}[/tex]

→ n=±2[tex]\sqrt{5}[/tex]  

⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆⋆

2) [tex]a^{2}[/tex] =90

✰ (Same as above) Take the square root of both sides ​a=±[tex]\sqrt{90\\}[/tex]

✰ Simplify [tex]\sqrt{90}[/tex] to 3[tex]\sqrt{10}[/tex]

→ a=±3[tex]\sqrt{10}[/tex]

Multiply: -z^3(5 + z - 4z^2)

Answers

- 5z^3 - z^4 + 4z^5 is the answer.

Evaluate 8/9 power of 2 as a fraction in simplest form

Answers

Answer:

64/81 or, 0.790123456 repeating

Step-by-step explanation:

use the properties of exponents to get 8^2/9^2 and then evaluate to get the answer.

Which rational number is equivalent to 2.42

Answers

Answer:

121/50

Step-by-step explanation:

121/150 =2.42

A fare meter in a taxi calculates the fare by starting at $2.40 when the trip starts, then adding $0.32 for every eighth of a mile traveled. If x represents the length of the trip in miles, what function models the total cost of the trip?

Answers

Answer:

i think its 7.5

Step-by-step explanation:

How do i find the solution(s) ?

Answers

Answer:

-8 , (0, -8)

Step-by-step explanation:

Y-intercepts

The y-intercept of a line is where a line intersects the y-axis, or the vertical axis.

Solution

Referring to the picture given, the y-intercept is -8 with the coordinates (0, -8)

Answer:

The vertex is (1,-9)

The y intercept is (0, -8)

Step-by-step explanation:

This is a parabola.  The vertex is the low point since the parabola is opening upwards.

The vertex is (1,-9)

The y intercept is where it crosses the y axis.  The y intercept is (0, -8)

Find the area and circumference of a circle with a radius of 18 in. Round
to the nearest hundredth.

Answers

ANSWER:-

where is the given part

Answer this pls ASAP

Answers

Answer:

19cm^(3)

Step-by-step explanation:

Answer:

V = 9π cm³

Step-by-step explanation:

We require to find the height (h) of the cylinders

The volume (V) is calculated as

V = Ah ( A is the base area and h the height ), then

3πh = 18π ( divide both sides by 3π )

h = [tex]\frac{18\pi }{3\pi }[/tex] = 6

Then the height of the smaller cylinder = 6 - 3 = 3 cm

V = 3π × 3 = 9π cm³ ← volume of smaller can

freeeeeeeeeeepointssssssssssssssssss

Answers

Answer:

thanks

Step-by-step explanation:

Answer:

Thank you so much! Have a great day! :)

Step-by-step explanation:

simplify ........ (256y²⁵⁶) ⅛
help asap!!!!!​

Answers

Answer:

2y^32

Step-by-step explanation:

Since 2^8 = 256, the eighth root of 256 is 2.

Next, we find the power of y by multiplying 256 and 1/8:  result is 32.

Complete answer:  2y^32

HELP ASAPPP PLEASEEEEEEEE...
NO FAKE ANSWERS OR LINK​

Answers

Answer:

B is the correct answer

Step-by-step explanation:

AND NO CHEATING v-v

,’l

Right triangle $ABC$ has one leg of length 6 cm, one leg of length 8 cm and a right angle at $A$. A square has one side on the hypotenuse of triangle $ABC$ and a vertex on each of the two legs of triangle $ABC$. What is the length of one side of the square, in cm

Answers

One side of the square has a length of 10 cm.

The triangle $ABC$ is a right triangle and it has one leg of length 6 cm and one leg of length 8 cm. Using the Pythagorean theorem, we can find the length of the hypotenuse:

c^2 = a^2 + b^2

c = √(a^2 + b^2)

c = √(6^2 + 8^2)

c = √(36 + 64)

c = √(100)

c = 10

So the hypotenuse of triangle $ABC$ has a length of 10 cm.

The square has one side on the hypotenuse of the triangle $ABC$ and a vertex on each of the two legs of the triangle $ABC$. Since the square is on the hypotenuse of the triangle, one side of the square has the same length as the hypotenuse of the triangle, which is 10 cm.

Therefore, one side of the square has a length of 10 cm.

To learn more about squares, refer to the link:brainly.com/question/13953405

#SPJ4

At Florida A&M University, the ratio of students from Florida to students not from Florida is about `3\ :\ 1`.



How many of its `12000` students are from Florida?

Answers

Based on the information given, the number of students from Florida will be; 9000 students.

What is an equation?

An equation is an expression that shows the relationship between two or more numbers and variables.

A mathematical equation is a statement with two equal sides and an equal sign in between. An equation is, for instance, 4 + 6 = 10. Both 4 + 6 and 10 can be seen on the left and right sides of the equal sign, respectively.

We are given that At Florida A&M University, the ratio of students from Florida to students not from Florida is about 3 : 1

The Total number of students = 12000

Fraction from Florida = 3/4

Fraction of students not from Florida = 1/4

Therefore, the students from Florida will be:

= 3/4 × 12000

= 9000

Hence, the number of students from Florida is 9000.

Learn more about equations here;

https://brainly.com/question/25180086

#SPJ2

The measures of the angles of a triangle are shown in the figure below. Solve for x.

Answers

A triangle has to add up to 180 degrees, so
106 + 48 = 154
180 - 154 = 26

ANSWER: 26 degrees

This should be right and I hope it helps :)

Trapezoid DEFG is dilated by scale factor of 2\3 to form trapezoid D'E'FG. Side E'F' measures 32. What is the measure of side EF?

Answers

Answer: 48

Step-by-step explanation:

Given

Trapezoid DEFG is dilated by a scale factor of  [tex]\frac{2}{3}[/tex]

[tex]E'F'=32[/tex]

Suppose the length of EF is [tex]x[/tex]

Multiply the side length of DEFG by [tex]\frac{2}{3}[/tex] to form E'F'

[tex]\Rightarrow E'F'=x\times \dfrac{2}{3}\\\\\Rightarrow 32=x\times \dfrac{2}{3}\\\\\Rightarrow x=16\times 3\\\Rightarrow x=48[/tex]

[tex]\therefore EF=48[/tex]

Help me ASAP!!
Which answer is the best estimate of the correlation coefficient for the variables in the scatter plot?
A. -0.95
B. -0.5
C. 0.5
D. 0.95

Answers

Answer:

b

Step-by-step explanation:

There is not a strong relationship between the points making the number 0.5 and it is going down so it is negative

Answer:

−0.5

Step-by-step explanation:

Delaney bought a crate for her puppy when it was 3 months old. The crate is in the shape of a rectangular prism. Since the puppy is getting bigger, Delaney wants to purchase a bigger crate. She decided that the dimensions of the new crate needs to be increased by 40% of the original length. Find the missing percentage.

The volume of the new crate is exactly _________% of the old crate.

Answers

Answer:

volume of the crate =40%

Step-by-step explanation:

volume of the crate =

using formula

L×B×H× dat_3

40 ×3=120

divide it by 3 month.therfore the volume°40

Here are the 3 questions

What is the length of AB?
What is the length of DE?
Are the circles congruent?

Thanks and please hurry!

Answers

Answer:

The length of AB is 4 and the length of DE is also 4. Yes, the circles are congruent.

How many ounces of a 28% alcohol solution and a 40% alcohol solution must be combined to obtain 51 ounces of a 32% solution?

Answers

Answer:

Number of ounces of 28% alcohol = x = 34 ounces

Number of ounces of 40% alcohol = y = 17 ounces

Step-by-step explanation:

Let us represent the

Number of ounces of 28% alcohol = x

Number of ounces of 40% alcohol = y

Our system of equations =

x + y = 51 ..... Equation 1

x = 51 - y

28% × x + 40% × y = 32% × 51

0.28x + 0.4y = 16.32......Equation 2

We substitute 51 - y for x

0.28(51 - y) + 0.4y = 16.32

14.28 - 0.28y + 0.4y = 16.32

- 0.28y + 0.4y = 16.32 - 14.28

0.12y = 2.04

y = 2.04/0.12

y = 17

Solving for x

x = 51 - y

x = 51 - 17

x = 34

Therefore,

Number of ounces of 28% alcohol = x = 34 ounces

Number of ounces of 40% alcohol = y = 17 ounces

Dilation result in what types of polygons

Answers

Answer:

Step-by-step explanation:

Similar polygons.  Only side lengths change; the angles remain the same through dilation.

Find the distance between (–2, –3) and (–6, –12). Round the answer to the nearest hundredth, if necessary.
a.
9.85 units
c.
13 units
b.
7.26 units
d.
17.49 units

Answers

Answer:

A. 9.85 units

Step-by-step explanation:

If $n$ is a positive integer such that $2n$ has 28 positive divisors and $3n$ has 30 positive divisors, then how many positive divisors does $6n$ have

Answers

As per the given equation the total number of positive divisors that $6$ has is 38.

What is the positive divisor?

The divisors (or factors) of a positive integer are the integers that evenly divide it.

The formula for calculating the total number of divisor of a number ′n′ where n can be represent as powers of prime numbers is shown as.

If N= paqbrc

Then total number of divisors = (a+1)(b+1)(c+1).

If we want to find the positive divisors for an integer n, we just take the integers 1, 2, 3, . . . , n, divide n by each, and those that divide evenly make up the set of positive divisors for n.

The divisors (or factors) of a positive integer are the integers that evenly divide it

To learn more about positive integer visit:

https://brainly.com/question/26051073

#SPJ4

if AG=5x-24 and GB=3x-12, find GB​

Answers

The value of line GB is 6

How to determine the value of the line

From the diagram shown, we can see that AG, GB and AB form a triangle with two of its sides being equal.

Also, line AG = line GB

Where;

Line AG = 5x - 24Line GB = 3x - 12

Then, we have;

Line AG = LIne GB

Substitute the expressions, we have;

5x - 24 = 3x - 12

Collect like terms

5x - 3x = - 12 + 24

Add or subtract like terms

2x = 12

Divide both sides by the coefficient of x

x = 12/ 2

x = 6

The, GB = 3(6) - 12 = 6

Hence, the value is 6

Learn more about line segment here:

https://brainly.com/question/17374569

#SPJ1

Other Questions
What is human trafficking Which of the following statements best explains differences between the finches? A. Some finches were born with beaks that allowed them to have better access to different sources of food. These finches reproduced and passed on their genes.B. The beaks of the finches changed so all of the finches could eat the same types of food.C. The beaks of the finches changed as the species of finches migrated to the same island.D. The beaks of the finches changed as the finches' body sizes changed. The characteristics of type one diabetes Factor quadratic trinomials2x^2+7x+63x^2+5x+2With method X pleaseee:( How do you graph a parent graph? Do you agree with Wittgenstein that philosophy should focus on language? Why or why not? Cultural differences that might influence the guest service experience include all of the following except diet greetings humor marriage What was the Selective Service Act and how did it impact the war? When considering the various resources factors of production which of the following is most likely to represent capital? Find the area. The figure is not to scale You can NOT have an in group without having an out group True False 3 chairs and 4 tables cost rs 7540. if the price of a chair is 220 find the price of table?ans - 7120 two equivalent ratios for 17:5? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA The table below shows information about how many fans there were at twofootball matches in a local tournament.What is the difference between the number of away fans at the semi-final and atthe final?Semi-finalFinalTotal number of fans250400Ratio of home fansto away fans6:47:3 Follow the constitution and the law even if I disagree with it what power or duty is this listed on Nika rolls an 8-sided cube with faces numbered 1 through 8. Which of the following statements is true? P(even number) = P(odd number) = P(number less than 8) = 1P(the number 9) = 1 Why might Great Britain's colonies have contributed tothe start of Ine Industrial Revolutionin Great Britain? What is irony What are the 3 types of irony and examples of each? Which question is a statistical question?A. How tall is the oak tree?B. How much did the oak tree grow in one year?C. What are the heights of the oak trees in the schoolyard?D. What is the difference in height between the oak tree and the pine tree?