A hiker starts hiking at the beginning of a trail at a point which is 200 feet below sea level. He hikes to a location on the trail that is 580 feet above sea level and stops for lunch.

a) What is the vertical distance between 200 feet below sea level and 580 feet above sea level?

b) How should we interpret the answer in the context of this problem?

Answers

Answer 1

jnhiujkijuuftdysedrtfhygjuioihugyfutdrserdcvhbjnkm

Answer:

poop

Step-by-step explanation:

poop


Related Questions

Which of the diagrams below represent a function from X to Y

Answers

Answer:

d

Step-by-step explanation:

because it is a one to one relation

The answer is d., its the only one that isnt x to 2 y's or y to 2 x's

What is the slope of the line represented by the equation 3x+4y= 1/2? –4/3 –3/4 3/4 4/3.

Answers

Answer:

-3/4 is the slope

Step-by-step explanation:

3x + 4y = 1/2

4y = -3x + 1/2

y = -3/4x + 0.125

m = -3/4

What is y=3x+13 in standard form?

Answers

Answer:

3 x − y = − 13

Step-by-step explanation:

Any equation that relates the first power of x to the first power of y produces a straight line on an x-y graph. The standard form of such an equation is Ax + By + C = 0 or Ax + By = C. When you rearrange this equation to get y by itself on the left side, it takes the form y = mx +b. This is called slope intercept form because m is equal to the slope of the line, and b is the value of y when x = 0, which makes it the y-intercept. Converting from slope intercept form to standard form takes little more than basic arithmetic.

TLDR:

To convert from slope intercept form y = mx + b to standard form Ax + By + C = 0, let m = A/B, collect all terms on the left side of the equation and multiply by the denominator B to get rid of the fraction.

Answer:

3x - y = -13

Step-by-step explanation:

y = mx + b

(This is the slope intercept form)

We want to change it to standard form, which is:

Ax + By = C

We want to rearrange as many of the numbers as we can, without actually changing the problem!

Ax = 3x

By = y

C = 13

So we must move the numbers from one side to another.

Whatever you do to one side, you do to the other.

y = 3x + 13

-3x + y = -3x - y

--------------------

-3x + y = 13

Since we can't have our "Ax" as a negative multiply everything by -1

-1[-3x + y = 13]

3x - y = -13

That is your answer.

the amount of money rachel earns varies directly with the number of hours she works. if sue earns $600 when she works 40 hours , how much will she earn for working 85 hours ?

Answers

Answer:

I think 500

Step-by-step explanation:

600 minus 40 mminus 85

1,275
Explanation : If she earns 600 dollars working for 40 hours, you can find the amount she earns working an hour by dividing 600/40 which will give you $15 an hour. From there it asks how much will she earn working 85 hours, so you multiply $15 by the 85 hours so you get 1,275

Write 2 and two-thirds as an improper fraction?

Answers

8/3,
2*3=6
6/3+2/3=8/3

Answer:

2 2/3

Step-by-step explanation:

Use the table here to answer the questions below.
1) Explain what Pablo did in each step of his work.
2) Explain what Karla did in each step of his work.
3) Are Pablo and Karla correct?
Please help due today!!

Answers

1. Pablo Used the Commutative property to Reorder the terms.

2. Pablo then Combined all his like terms.

3. Pablo then Divided 21 by 3x to get 3(7+x)

4. Pablo then subtracted 7 from 13

5. He got x = 6
Pablo did his math wrong.

Karla Did her work correct.

1. Karla used the commutative property to reorder the terms

2. she then combined her like terms

3. She subtracted 21 from itself and 39, leaving 3x and 18 on different sides of the equal sign

4. She divided 3x by 3 which equals x and 18 by 3 which equals 6.

5. Karla is correct.

Answer:

Pablo Used the Commutative property to Reorder the terms. Pablo then Combined all his like terms. Pablo then Divided 21 by 3x to get 3(7+x). Pablo then subtracted 7 from 13. He got x = 6

Pablo did his math wrong.

Karla Did her work correctly. Karla used the commutative property to reorder the terms. She then combined her like terms. She subtracted 21 from itself and 39, leaving 3x and 18 on different sides of the equal sign. She divided 3x by 3 which equals x and 18 by 3 which equals Karla is correct.

Step-by-step explanation:

What is the answer to this?

Answers

Answer:

C

High Hopes^^

Barry-

What is the coefficient

Answers

Answer:

5, the one with the variable.

is the coeficiant

Step-by-step explanation:

Answer:

5

Step-by-step explanation:

The coefficient is always before the variable. It's always going to be a number.

A dealer paid kshs 240,000 to an agent as commission for sale of a car .The commission was 3 percent of the car price how much money did the dealer remain with from the sale of the car if he also had to pay the government v.A.T at 16 percent of the total car

Answers

Answer:

kshs 6,480,000

Step-by-step explanation:

Since, kshs 240,000 represent the 3% of the car price, you can use a rule of three to calculate the amount that represents 100%:

240,000 →   3%

     x       →  100%

x=(240,000*100)/3

x=8,000,000

So, the price of the car is kshs 8,000,000 and you can calculate the 16% of this, to find the amount that the dealer had to pay as government V.A.T:

8,000,000*16%=1.280.000

Now, you can subtract the comission and the government VAT from the car price:

8,000,000-240,000-1,280,000=6,480,000

According to this, the answer is that the dealer remained with kshs 6,480,000 from the sale of the car.

Charles scored 75% on a test and got six questions wrong. How many questions were on the test?

Answers

Answer:

24 question total

Step-by-step explanation:

[tex]\frac{0.25}{6}=\frac{1}{x}[/tex]

im here to help :)

Red

Answer:

24 problems were on the test

Step-by-step explanation:

6/24 =1/4 =25%

18/24=3/4=75%

If (fail) test were 25% were6 problems wrong, and 25% is 3 times less than 75%, then 18 is 3x6=18 problems correct

What is five times 3 and 3/4

Answers

Answer:

18.75

Step-by-step explanation:

I KNOW ITS RIGHT LOL HOPE THIS HELPED

5 times 3 is 15 simple but 5 times 3/4 or .75 is 3.75

Lisa and her date spent $87.70. They want to leave a 20% tip. What amount would be reasonable for the tip?​

Answers

Answer:

17.54 would be tip so reasonable would be 20$

Step-by-step explanation:

The product of two consecutive integers is 19 less than their sum.
What equation represents the statement above? ​

Answers

Answer:

is there any choices?

Step-by-step explanation:

A turtle traveled
1/10 miles in 1/2 hour. What was the turtle's rate in miles per hour?

A: 1/20
B: 1/12
C: 1/6
D: 1/5


Answers

2/10 ———> simplified is D. 1/5

The turtle's rate in miles per hour is 1/5 miles/hr.

What are algebraic expressions?In mathematics, an expression or mathematical expression is a finite combination of symbols that is well-formed according to rules that depend on the context.Mathematical symbols can designate numbers (constants), variables, operations, functions, brackets, punctuation, and grouping to help determine order of operations and other aspects of logical syntax.

Given is that a turtle traveled 1/10 miles in 1/2 hour.

Rate is defined as the distance travelled in a unit hour {1 hour}.{R} = x/t.

We can write the rate as -

{R} = (1/10)/(1/2)

{R} = (1/10) x 2

{R} = 1/5 miles/hr

Therefore, the turtle's rate in miles per hour is 1/5 miles/hr.

To solve more questions on algebraic expressions, visit the link below -

brainly.com/question/1041084

#SPJ2

how do you solve this pls help!!!​

Answers

Answer:

y = 1

x = -0.75

Step-by-step explanation:

The alternate angles theorem states that if two parallel lines are cut by a transversal, then each pair of alternate interior angles are equal.

21y - 1 = 4x + 23

21y - 24 = 4x

5.25y - 6 = x

21y - 1 = 4x + 23

21y = 4x + 24

y = 4/21(5.25 - 6) + 1.14

y = 1 - 1.14 + 1.14

y = 1

5.25(1) - 6 = x

-0.75 = x

HURRY LOTS OF POINTS!!

Answers

Answer:

they are going to half to sell 100 tickets. 5 times 100 is 500

Step-by-step explanation:

pls make me brainliest

Answer:

500

Step-by-step explanation:

What is 3.4550 rounded to 1 decimal place? *

3
3.4
3.46
3.5

Answers

Answer:

3.5 (D)

Step-by-step explanation:

focusing on the right side of the decimal, 5 rounds 5 to 6. 6 rounds 4 to 5. Anything 5 or above rounds up! So the .5 rounds 4 to 5, making the answer 3.5. So sorry if this doesn't make sense, its kind of hard to explain.


What is the unit rate for meters per second if a car travels 374 meters in 17 seconds?

Answers

Answer:

22 meters per second.

Step-by-step explanation:

374 divided by 17 = 22.

Answer:

22

374meters. 17

(/). divided by (/)

17seconds 17

Equals 22 meters per second

Step-by-step explanation:

hope this helps and if ur feeling genous mark brainliest

Does anyone know this?

Answers

Answer:

obtuse scalene

Step-by-step explanation:

Answer:

Obtuse Scalene

Step-by-step explanation:

all the sides have different numbers

round to the tenth. i need the answer plss​

Answers

Answer: D

Step-by-step explanation:

Answer:

C=6.4ft

Step-by-step explanation:

a^2 + b^2 = c^2

4^2 + 5^2 = c^2

4 + 4 = 16

5 + 5 = 25

16 + 25 = c^2

41 = c^2

Now you will need to find the square root of 41 which gives you 6.40 and you just round to nearest tenth..

HOPE THIS HELPS!!

What is the value of n?
What is the value of n?

Answers

Answer:

42

Step-by-step explanation:

You get 42 by looking at the denominators 7 and 21. You times by 3 to get from 7 to 21, so you times 14 by 3 to get n, which is 42.

Answer:

42

Step-by-step explanation:

On the bottom 7 was multiplied by 3 so you would do the same to 14.

How do I do this I tried and still don’t get it

Answers

Answer:

y=0

y=2

y=4

y=6

y=8

next your y's is

0

1

2

3

4

Your x,y is

0,0

1,2

2,4

3,6

4,8

Explanation

So for each X you must multiply by 2

to find your Y

the table shows ordered peirs of the function y= 8 - 2x what is the value of y when x = 8

Answers

Answer:

y = -8

Step-by-step explanation:

All we need to is substitute for x and solve for y.

y = 8 - 2x

y = 8 - 2(8)

y = 8 - 16

y = -8

Best of Luck!

100 POINTS!!!!!!!!!!! ( I NEED FAST ANSWERS ) The slope of the line through the points (8,4) and (6.5) is 2.*
False
True

Answers

Answer:

False

Step-by-step explanation:

The slope of that line is -1/2

False

The slope of the line is actually -.05

I would have explained this further but u need it fast so..

Which is the graph of the line LaTeX: y-2=3\left(x-1\right)y − 2 = 3 ( x − 1 )?

Answers

Answer:

D.

Step-by-step explanation:

The equation given takes the point-slope form which is, [tex] y - b = m(x - a) [/tex]. Where,

(a, b) = (x, y) coordinates of a point on the line.

m = slope of the line .

To find which graph has a line equation of [tex] y - 2 = 3(x - 1) [/tex], look for the points which will give you something almost exactly as the equation if you substitute their values into [tex] y - b = m(x - a) [/tex].

Let's consider option D.

We have a given point (1, 2). a = 1, b = 2.

Substitute these into [tex] y - b = m(x - a) [/tex]

We have:

[tex] y - (2) = m(x - (1)) [/tex]

[tex] y - 2 = m(x - 1) [/tex]

As you can see, this looks almost exactly as

[tex] y - 2 = 3(x - 1) [/tex].

If you want to be certain that option D is the answer, find m by using the coordinates of any other point on the line and plug into [tex] y - 2 = m(x - 1) [/tex] to find m:

In graph D, let's take the points (0, -1)

[tex] -1 - 2 = m(0 - 1) [/tex]

[tex] -3 = m(-1) [/tex]

[tex] -3 = -m [/tex]

Divide both sides by -1

3 = m

m = 3.

Therefore, option D is the graph of the line [tex] y - 2 = 3(x - 1) [/tex].

what is equivalent to sq root -27

Answers

Negative numbers don’t have real square roots since a square is either positive or 0

[tex]\sqrt{-27}=\sqrt{27}\sqrt{-1}=\boxed{3\sqrt{3}i}[/tex].

Result is a complex irrational number.

Hope this helps.

HELP!! This is for my math, Picture added.

Answers

Answer:

x=3, x=[tex]-\frac{5}{2}[/tex]

Step-by-step explanation:

2x^2-x-15=0

2 times -15 equals -30, so plug in 5x and -6x for -x

2x^2-6x+5x-15  factor,

2x(x-3)    5(x-3)

x-3=0      2x-5=0

x=3    x= -5/2

3. Evaluate x: y for x = 3 and y = 12. a. 0.25 b. 4 c. 9 d. 36

Answers

Answer:

4

Step-by-step explanation:

plug it in and 3 divided by 12 is 4

is -9/3 a rational number

Answers

Answer:

no

Step-by-step explanation:

Answer: Yes

Step-by-step explanation: The rational numbers include all positive numbers, negative numbers, and zero that can be written as a ratio (fraction) of one number over another. Whole numbers, integers, fractions, terminating decimals, and repeating decimals are all rational numbers.

Find the variables.
(x - 10)
104°
X=I

Answers

Answer: 114 Degrees

Step-by-step explanation: Add 10 to 104 and there is X and I is equivalent to X.

Other Questions
78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations factorizar por el motodo de aspas [tex]12x^2 = 3x + 2[/tex] Consider this expression. -3x2- 24x - 36 What expression is equivalent to the given expression? Read the poem. Then, select the correct answerexcerpt adapted fromI Wandered Lonely as a Cloudby William WordsworthI wandered lonely as a cloudThat floats on high o'er vales and hills,When all at once I saw a crowd,A host, of golden daffodils;Beside the lake, beneath the trees,Fluttering and dancing in the breeze,Continuous as the stars that shineAnd twinkle on the milky way.They stretched in never-ending lineAlong the margin of a bayTen thousand sawl at a glance,Tossing their heads in sprightly dance.For oft, when on my couch I lieIn vacant or in pensive moodThey upon that inward eyeWhich is the bliss of solitude:And then my heart with pleasure fills,And dances with the daffodils.Which word best describes the author's tone?Aadmiring.desperateOC somberOD playful \How does the allusion to Ham affect the meaning of the text?It emphasizes Douglass's desire to be free.It allows Douglass to discredit using the Bible to justify slavery.It highlights the similarities between enslaved people and those who enslave them.It compares slavery in the modern world to slavery in Biblical times. Write the definition of a function named count that reads all the strings remaining to be read in standard input and returns their count (that is, how many there are) So if the input was: hooligan sausage economy ruin palatialthe function would return 5 because there are 5 strings there. PLSS HELPP What is the value of x in this equation?4x 2(2x 2) = 2(2x 4) The company's profit will be exactly $0 if it makes and sells jackets. The company will make a profit if it makes and sells jackets, but will not make a profit if it makes and sells jackets why are Hispanics not a race in the u.s but only defined as ethnicity?